A total of 51 tissue samples from patients with myocardial failure (mean age, 67.8±17.4 years; 31 males and 20 females) were collected, as well as 50 normal myocardial tissue specimens (mean age, 64.6±16.9 years; 27 males and 23 females), from July to December 2014 at Weifang People's Hospital (Weifang, China). No differences in the age (P=0.352) and sex (P=0.849) distributions between the myocardial failure and control group were detected. All participants provided written informed consent following institutional review board approval at the Weifang People's Hospital. All aspects of this research were approved by the Ethics Committee of The Weifang People's Hospital. The tissue samples were collected and frozen in liquid nitrogen. Complete patient records and the pathological data were obtained. The following inclusion criteria were used: i) >20 years of age; ii) suspected symptoms or signs of heart failure without obvious alterations within 1 week; and iii) New York Heart Association (NYHA) class II or III symptoms. The diagnosis of heart failure was based on both the symptoms and the echocardiography results. The exclusion criteria included severe valvular heart disease, acute pulmonary embolism, severe infection or sepsis, acute decompensated heart failure or diagnosis of heart failure by echocardiography and radionuclide imaging or magnetic resonance imaging within the past 3 months. The normal controls were included from the organ donation.

A total of 24 male C57BL/6J (B6) mice (4 weeks old) were obtained from Vital River Laboratories Co., Ltd. (Beijing, China) and were routinely housed under specific pathogen free (SPF) conditions at 22±2°C with 40–60% humidity in a 12 h light/dark cycle. Animals had free access to food and water. Doxorubicin (DOX), an anthracycline antibiotic commonly used as chemotherapy medication, is frequently used to establish animal models of cardiomyopathy (20). The animal model was established as previously described using 6 intraperitoneal injections with 2.5 mg/kg DOX (Adriamycin^®; Pfizer, Inc., New York, NY, USA) every 48 h to achieve an accumulative dose of 15 mg/kg (21). The control group was fed a normal diet and injected with physiological saline. This total dose was selected according to a study by Zhang et al (13). Following the observation period (1 and 6 months following treatment) and echocardiography, the mice were euthanized by placing them into a chamber filled with isoflurane vapor until respiration ceased, and the heart tissue was collected for examination. Histological alterations in normal B6 mice and the ranolazine treated group were detected and the arteries were measured by echocardiography contrast at 1 and 6 months post-AAC. All animal experiments were undertaken in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, with the approval of the Weifang People's Hospital Animal Care and Use Committee.

Under ketamine (70 mg/kg)/xylazine (5 mg/kg) anesthesia, 28 rats were subjected to restrictive banding of the suprarenal abdominal aorta at 16 to 18 weeks of age using a blunt 23G needle as a template. The needle was tied tightly against the aorta above the renal arteries (causing visible kidney blanching), and then removed, leaving the suture in place to partially restore blood flow (visually confirmed).

Recombinant adenovirus amplification and cell transfection were subsequently performed. The 293T cells were plated in fresh Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at a density of 1×10⁵ cells/ml. When the adherent cells reached 60% confluence, they were infected with an empty recombinant adenovirus AdGFP (Vector Laboratories, Inc., Burlingame, CA, USA), recombinant adenovirus AdCx3 expressing miR-127, or recombinant adenovirus AdSmad1 expressing small interfering (si)-miR-127 (both Invitrogen; Thermo Fisher Scientific, Inc.). When the floating cells accounted for 50% of all cells, the cells were harvested, collected following centrifugation at 250 × g for 5 min in 37°C, and resuspended in 500 µl of DMEM. Following incubation in liquid nitrogen for 1–2 min, the tubes with cells were placed in a 37°C water bath with continuous oscillation. Following cell lysis, the samples were vortexed for another 1–2 min. The above steps were repeated 4–5 times, followed by centrifugation at 1,000 × g for 10 min in 4°C, and the supernatant containing the recombinant adenoviral extract was used to transfect the H9C2 cells (American Type Culture Collection, Manassas, VA, USA).

A total of 2 ml of the H9C2 cells at a density of 0.5×10⁵ cells/ml were seeded into 6-well plates and cultured in DMEM with 10% FBS for 24 h, followed by the addition of the corresponding recombinant adenovirus for transfection. 0, 2.5, 5 and 10 µM siRNA were used in the transfection. siRNAs were transfected with Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 6 h according to the manufacturer's manual. The sequences of miR-127 and si-miR-127 were CUGAAGCUCAGAGGGCUCUGAU and CACTTCGAGTCTCCCGAGACUUA, respectively. After transfection for 12 h, cells were washed with culture media and used for subsequent experiments. Total RNA was extracted after culturing the cells for 30 h to detect the expression of target genes, using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.

The expression of miR-127 was detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) in tissue samples from patients with myocardial failure and normal control tissue, as well as H9C2 cells. RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and then centrifuged for 10 min at 4,000 × g and 4°C. The supernatant was transferred into a new Eppendorf Tube (EP; Eppendorf, Hamburg, Germany) and allowed to stand for 5 min at room temperature. Subsequently, the following steps were conducted: 200 µl of chloroform was added, the samples were vortexed for 15 sec and then left to stand for 3 min at room temperature; the samples were centrifuged at 4,000 × g at 4°C for 15 min; the top layer was transferred to a new EP and an equal volume of isopropanol was added into each EP at room temperature for 10 min; the samples were centrifuged at 4,000 × g and 4°C for 10 min, and the supernatant is discarded; the pellets were washed with 75% ethanol, centrifuged at 2,500 × g and 4°C for 5 min and supernatant was discarded; RNA was left to dry and 20 µl DEPC water was subsequently added to dissolve the extracted RNA. The reverse transcription kit was purchased from Takara Biotechnology Co., Ltd. (Dalian, China). The temperature protocol for reverse transcription was as follows: 37°C for 15 min; 85°C for 5 sec and 4°C for 5 min. qPCR was subsequently used to detect the expression of miR-127. The following primer sequences were used: miR-127 forward, 5′-GCGAGCTACATTGTCTGCTGGGTT-3′ and reverse, 5′-GTCGAGGGTCCGAGGTATTCCG-3′; U6 forward, 5′-CGGCGGTAGCTTATCAGACTGATG-3′ and reverse, 5′-CCAGTCGAGGGTCCGAGGTATT-3′. The following thermocycling conditions were used for the PCR: Initial denaturation at 95°C for 10 min; 40 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec and extension at 72°C for 30 sec; followed by melting curve analysis. All experiments were performed in triplicate. Finally, the 2^−ΔΔCq method was performed to calculate the relative expression (22).

The TGF-β1 and Smad3 protein expression levels were detected by WB in mice with myocardial failure. The total proteins were extracted using RIPA lysis buffer (OP-0003, Epigentek Group, Inc., Farmingdale, NY, USA). A bicinchoninic acid protein assay was performed to determine protein concentration. Equal amounts of protein (50 µg/lane) were separated by 8–10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Prior to incubation with primary antibodies, the PVDF membrane was treated with 0.1% Tween-20 in Tris-buffered saline (TBST) containing 50 g/l skimmed milk at room temperature for 4 h. The primary antibodies, including rabbit monoclonal anti-TGF-β1 (1:1,000; cat. no. ab25121; Abcam, Cambridge, MA, USA), rabbit polyclonal anti-Smad3 (1:500; cat. no. 9523), rabbit polyclonal anti-p-Smad3 (1:500; cat. no. 8769), rabbit polyclonal anti-Smad2 (1:500; cat. no. 5678; all Cell Signaling Technology, Inc., Danvers, MA, USA), mouse monoclonal α-tubulin (1:1,000, cat. no. sc-398103) and mouse monoclonal anti-GAPDH (1:1,000; sc-51907; both Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were used in the current study. After treatment with primary antibodies for 1 h at room temperature, the membranes were rinsed with TBST and incubated with anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:2,000; cat. no. SC-2004, Santa Cruz Biotechnology, Inc.) at room temperature for 1 h. Chemiluminescent detection was performed with the Enhanced Chemiluminescence kit (Pierce; Thermo Fisher Scientific, Inc.). The amount of the protein of interest, which was expressed using arbitrary densitometric units, was normalized to the densitometric units of GAPDH.

The cardiac tissue (4 µm thick) was obtained from the mice, fixed with 10% formaldehyde at room temperature for 12 h, dehydrated, embedded in paraffin at room temperature for 1 h and stored at 4°C. The tissue section was incubated at 65°C for 1 h according to a procedure for dewaxing (23,24). Samples were stained with hematoxylin for 1 min, followed by eosin staining for 10 sec at room temperature, and, then the samples were dried at room temperature and sealed. The middle part of the visual field was examined by light microscopy (magnification, ×20) and the field was assessed by three different pathologists (25).

The tissue from myocardial failure patients and controls were fixed with neutralized formaldehyde overnight at 4°C and dehydrated the next day. Subsequently, the tissue was 4 µm and placed at 4°C. The film was cooled and placed in a slicing machine for 1 h washed with PBS three times for 5 min. Following washing, sodium citrate buffer (pH 6.0) was boiled at high-pressure for antigen repair for 5 min and washed with PBS 3 times for 5 min. The tissue sample was then soaked in hydrogen peroxide for 30–60 min at room temperature, washed with PBS three times for 5 min, and blocked with 10% fetal bovine serum. The samples were incubated with anti-FASN (1:100; LS-C104946; BD Biosciences, Franklin Lakes, NJ, USA), anti-SCD1 (1:50; sc-515844) and anti-UCP1 (1:100; sc-293418; both Santa Cruz Biotechnology, Inc., Dallas, TX, USA) antibodies overnight at 4°C. The samples were washed with PBS 3 times for 5 min. Following washing, goat-anti-mouse secondary antibody was added (1:100, A32723; Invitrogen; Thermo Fisher Scientific, Inc.) with 1% bovine serum albumin (BSA; Baoman Biological Technology Co., Ltd, Shanghai, China) at 37°C for 1 h. DAB was used to subsequently stain the samples at 37°C for 5 min, which were then washed with PBS 3 times for 5 min and the reaction was terminated. The samples were stained with hematoxylin for 3 min at room temperature, sealed and images were captured. PBS instead of the primary antibody was used as a negative control.

When the H9c2 cells reached 70% confluency, they were cultured in DMEM with or without DOX (10 µM) for 24 h. The H9C2 cells in the treatment and control groups were washed with PBS 3 times and fixed with 4% paraformaldehyde for 10 min at room temperature. Following 3 washes with PBS, the cultured cells were blocked with 10% BSA (MP Biomedicals, LLC, Santa Ana, CA, USA) for 1 h and incubated overnight at 4°C with the Smad3 and TGF-β1 primary antibodies described above. The anti-TGF-β1 antibody was diluted 1:200 (cat. no. ab25121, Abcam) and anti-Smad3 antibody was diluted 1:500 (cat. no. 51-1500; Thermo Fisher Scientific, Inc. USA). The cells were incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody (1:100; cat. no. A-11034; Invitrogen) at 37°C for 1 h and stained with 4,6-diamino-2-phenyl indole at 37°C for 5 min to visualize the nuclei. The images were captured using a fluorescence microscope (model DMI-4000B; Leica Microsystems GmbH, Wetzlar, Germany).

Lipid distribution in heart tissues was examined by oil red O staining. Mouse samples were fixed with 10% formalin for 30 min in room temperature and sliced into 10-µm-thick sections with a cryostat. Next, the tissues were washed in PBS for 30 sec, washed in 60% isopropyl alcohol for 1 min, and stained by 0.5% oil red O for 10 min at 37°C. Thereafter, slices were fractionated with 60% iso-propyl alcohol for 2 min, washed with PBS solution for 2 min, and stained with 0.25% hematoxylin for 5 min in room temperature. Following a further 2 min wash in PBS, slices were colored with 0.1% lithium carbonate for 30 sec at room temperature, washed with PBS solution for 5 min and coverslipped (26). The slices were visualized using a Nikon 80i light microscope (Nikon Corporation, Tokyo, Japan) at magnification, ×20.

To anaesthetize each mouse, avertin (2,2,2 trimethylethanol; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany; 240 mg/kg) was administered into the intraperitoneal space prior to electrocardiographic detection and echocardiography. Subsequently, the mice were fixed on a test bed according to the connection for the right upper limb, left upper limb, left lower limb, and right lower limb. Subsequently, the electrode needle was injected subcutaneously into the animal limbs and the electrocardiography was recorded. Transthoracic echocardiography was performed at the end of the observation period to determine heart function using an ultrasonic apparatus (Voluson E8; GE Healthcare, Chicago, IL, USA; 15-MHz probe) with mice being lightly sedated by 1.5–2% isoflurane. Cardiac relaxation was assessed by first derivative of left ventricular pressure (dP/dt). The left ventricular systolic pressure (LVSP) was detected through the BL-420 multi-channel physiological system. A 2-dimensional echocardiogram from the apical view was used to determine the systolic ejection fraction by planimetry of the left ventricle.

All experimental data are presented as the mean ± standard deviation and were analyzed using Image-Pro-Plus 6.0 (Media Cybernetics, Inc., Rockville, MD, USA) and Graph Pad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA) statistical software. One-way analysis of variance followed by Bonferroni's multiple comparisons test was used to compare multiple groups and paired t-test was used to compare two groups. P<0.05 was considered to indicate a statistically significant difference.

To detect the expression of miR-127 in patients with myocardial failure, an RT-qPCR method was used to measure the expression levels of miR-127 in tissue samples of 51 patients with myocardial failure and 50 normal controls. The results indicated that the expression of miR-127 in the myocardium significantly increased compared with the control group (P<0.001; Fig. 1A). The overexpression of miR-127 in myocardial failure suggests that miR-127 may serve an important role in the development of myocardial failure. Oil red O staining indicated accumulation of large amounts of lipids in patients with myocardial failure, compared with healthy controls, which suggested that heart lipid accumulation may affect the normal function of myocardial cells (Fig. 1B). Detection of FASN, SCD1 and UCP1 by immunohistochemistry suggested that the accumulation of fat was more severe in patients with myocardial failure compared with the control group (Fig. 1C).

In the present study, a drug-induced mouse model of myocardial failure was successfully established. An advanced study of heart function was conducted by echocardiography. AAC and the ejection fraction were significantly reduced in the heart failure model compared with the control mice (Fig. 2A). To detect the pathological alterations, H&E staining was performed using the tissues from both the heart failure model and the control mice. The results indicated that cardiomyocytes were significantly hypertrophic following induction, especially after 6 months of induction (Fig. 2B). The left ventricular systolic pressure (LVSP) in B6 mice after induction was significantly increased after 1 month compared with the control mice, as indicated by the results of the echocardiographic analysis (Fig. 2C). The maximum left ventricular ejection pressure was significantly decreased in mice after 6 months of induction (P<0.001; Fig. 2D).

A model of myocardial failure was successfully established in mice and it was observed that miR-127 expression significantly increased following DOX induction compared with the untreated mice (Fig. 3A). Expression of TGF-β1 and Smad3 in myocardial tissue induced by DOX markedly increased compared with the control group (Fig. 3B and C).

Following transfection with si-miR-127, RT-qPCR demonstrated that the expression of miR-127 was decreased in the 6 months post-AAC siRNA group, compared with 6 months post-AAC group alone (Fig. 4A) and the expression of TGF-β1 and Smad3 was positively correlated with miR-127 (Fig. 4B). TGF-β, as a transcription factor, is located in the nucleus and involved in the regulation of cell function. When the expression levels of miR-127 were decreased by siRNA, the TGF-β1 expression in the nucleus was significantly reduced, which inhibited the Smad3 signal transduction (Fig. 4C).