Contributed equally
Insufficient bone volume remains a key issue when using dental implants. Adipose tissue-derived stem cells (ADSCs) can accelerate bone healing when combined with dental implants. To improve the application of ADSCs for dental uses, the present study aimed to identify optimal implantation conditions. Mesenchymal stem cell-derived exosomes can induce naïve stem cells to differentiate through the osteogenic lineage. In the present study, exosomes derived from 3T3L1 preadipocytes (3T3L1-exo) were purified and characterized. The effects and potential mechanisms of 3T3L1-exo on 3T3L1 cell ossification were examined by reverse transcription-quantitative polymerase chain reaction, western blotting, electron microscopy, RNA sequencing and histological analysis. The current study confirmed that 3T3L1-exo enhanced 3T3L1 preadipocyte osteogenic differentiation, as revealed by upregulation of osteogenic differentiation-associated genes and increased Alizarin Red staining. Furthermore, the microRNA (miR) expression profiles of 3T3L1-exo and 3T3L1 preadipocytes were sequenced and compared. The results of a further analysis demonstrated that miR-223 expression was reduced in 3T3L1 preadipocytes stimulated by 3T3L1-exo compared with in unstimulated cells. This finding suggested that 3T3L1-exo promoted 3T3L1 bone formation by decreasing miR-223 through a competitive mechanism, another miRNA, or another factor. The mechanism by which miR-223 is decreased warrants further investigation. In conclusion, the application of 3T3L1-exo may be useful for investigating preadipocyte-induced bone regeneration.
Dental implantation has been carried out for the last 25 years and involves placing artificial tooth roots into the jaw to hold a replacement tooth or bridge following tooth loss. The success of long-term dental implant placement relies on essential interactions between the jawbone and dental implant (
Cell transplantation technologies may address the limitations of bone transplantation (
Recent evidence has suggested that the secreted factors released by MSCs are more beneficial in tissue regeneration than their direct tissue intercalation and differentiation (
MSC-derived exosomes (MSC-exo) can induce naïve stem cells to differentiate through the osteogenic lineage (
Although immortalization compromises the differentiation potential of the MSCs, it does not affect the production or quality of the exosomes for therapy (
The 3T3L1 murine preadipocyte cell line was obtained from the American Type Culture Collection (Manassas, VA, USA) and cells were maintained in Dulbecco's modified Eagle's medium (DMEM: high-glucose, 4,500 mg/l; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal calf serum (Gibco; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2 For preparation of exosomes, 3T3L1 cells were seeded to 80% confluence in 100-mm tissue culture dishes. Cells were then cultured for 2 days in the presence of medium containing 2% exosome-free serum (obtained by ultracentrifugation of serum at 100,000 × g for 14 h at 4°C).
In accordance with a previously reported method (
To determine the effects of 3T3L1-exo on 3T3L1 cell survival, cell apoptosis and proliferation assays were performed. Briefly, cells were stimulated with 2 µg/ml 3T3L1-exo for 24 h prior to analysis of the degree of apoptosis or proliferation at 37°C with 5% CO2. For the detection of apoptosis, 2×105 cells were stained with fluorescein isothiocyanate-Annexin V (BD Pharmingen; BD Biosciences, San Diego, CA, USA) and propidium iodide (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 5 min at 4°C in the dark. The cells were then analyzed by fluorescence-activated cell sorting to identify positively stained apoptotic cells, as described previously (
For the detection of proliferation, 10 µl Cell Counting kit-8 reagent (7Sea Biotech, Shanghai, China) was added to each well (2×104/well) in a 96-well plate for 4 h at 37°C, as described previously (
For osteogenic differentiation, 3T3L1 cells were plated at a density of 5×104 cells/well in 12-well plates for 24 h prior to induction. Osteogenic differentiation was induced by culturing the 3T3L1 cells in osteogenic differentiation medium (ODM, DMEM supplemented with 20 mM β-glycerol phosphate, 50 µg/ml ascorbic acid and 100 nM dexamethasone) for 21 days; the medium was replaced every 3–4 days (
RT-qPCR was used to determine the expression levels of osteogenic differentiation-associated genes in 3T3L1 cells stimulated by 3T3L1-exo or pretreated with 10 µM transforming growth factor-β (TGF-β1) inhibitor (SB431542) at 37°C for 30 min, and miRNA expression in 3T3L1-exo or 3T3L1 cells. Briefly, RNA was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and cDNA was synthesized using PrimeScript™ RT Reagent kits (Takara Biotechnology Co., Ltd., Dalian, China) prior to qPCR, according manufacturer's protocol.
The expression levels of six pro-osteogenic genes were analyzed. The genes and primers used in the present study are listed in
In accordance with a previously reported method (
Osteogenic differentiation was detected using ARS on day 21, in order to quantify mineralization. For mineralization quantification, 40 mM ARS (Sigma-Aldrich; Merck KGaA) was prepared in dH2O (pH 4.1). Cells (3T3L1; 1×105/well) were cultured in ODM and 2 µg/ml 3T3L-exo for 21 days, rinsed three times with PBS, and fixed in 10% (v/v) buffered neutral formalin (Sigma-Aldrich; Merck KGaA) for 15 min at room temperature. The cells were then rinsed three times with dH2O and incubated at room temperature in ARS for 20 min with gentle agitation. Following the aspiration of unincorporated ARS, cells were rinsed four times with dH2O. Images of stained cells were subsequently captured.
Total RNA was prepared from 3T3L1 cells and 3T3L1-exo using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). RNA quantity was determined using an Agilent 2100 system (Agilent Technologies, Inc., Santa Clara, CA, USA). cDNA sequence libraries were established, sequenced and analyzed by Beijing Genomics Institute (Beijing, China) using the BGISEQ-500 sequencing technique (MGI Tech Co., Ltd., Shenzhen, China). Cluster analysis was performed using pheatmap in R software version 3.1.1 (
In accordance with a previously described method (
To induce miR-223 overexpression, synthetic 100 nM miRNA mimics were transfected into 3T3L1 cells (2×105/well) using 3 µl INTERFERin® small interfering RNA transfection reagent (Polyplus-transfection SA, Illkirch, France) on a 24-well plate at 37°C for 24 h. The miR-223 mimic and NC mimic (Shanghai GenePharma Co., Ltd., Shanghai, China) sequences were as follows: miR-223 mimic forward, 5′-UGUCAGUUUGUCAAAUACCCA-3′ and reverse, 5′-GGGUAUUUGACAAACUGACAUU-3′; NC mimics forward, 5′-UUCUCCGAACGUGUCACGUTT-3′ and reverse, 5′-ACGUGACACGUUCGGAGAATT-3′.
Data are presented as the means ± standard error of the mean. Data were analyzed by unpaired t-test or one-way analysis of variance followed by Tukey's post-hoc test using GraphPad Prism 7 software (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.
Exosomes were isolated from 3T3L1 cells cultured under normal growth conditions (3T3L1-exo). Exosome size and morphology were determined using electron microscopy. Exosomes were revealed to range between 50 and 100 nm in size, and exhibited a typical rounded shape (
To determine the effects of 3T3L1-exo on 3T3L1 cell survival, 3T3L1 preadipocyte proliferation and apoptosis were detected following stimulation by 3T3L1-exo. Exosomes did not affect 3T3L1 cell proliferation, even with an increased concentration (
Since 3T3L1-exo had no effect on 3T3L1 cell survival, and because MSC-exo has been reported to mediate osteogenic differentiation of MSCs, preadipocytes and mature osteoblasts (
The present findings suggested that 3T3L1-exo promoted the osteogenic differentiation of 3T3L1 cells. RUNX2 activates and regulates osteogenesis and acts as a target gene for numerous signaling pathways, including TGF-β1, bone morphogenetic protein, Wnt, Hedgehog and Nel-like protein type-1 (
To explore the mechanism by which 3T3L1-exo promoted 3T3L1 osteogenic differentiation, 3T3L1 cells and 3T3L1-exo were sequenced to determine miRNA profiles, and a similarly wide distribution profile of read lengths was confirmed (
In the present study, miR-223 was highlighted as a potential candidate target; this miRNA is a key regulatory factor in osteoclast and osteoblast differentiation (
Clinical bone implants often require bone fillers or enhanced regeneration due to a shortage of bone. In dentistry, a significant proportion of patients that need implants require increased bone volume prior to implant placement. The clinical gold standard for bone grafting is an autograft; however, this method has limitations, including donor-site morbidity, limited availability of grafting material and compromised bone quality in patients with osteoporosis (
Bone regeneration requires the migration of specific cells to the healing site to proliferate there and to provide a biological substrate for new tissue growth. BMSCs have the ability to form bone; therefore, bone marrow transplantation is used clinically in combination with osteoconductive materials to augment bone healing (
Because the numbers of stem cells are limited, agents that promote their differentiation are required. To promote bone formation, specific growth factors are often applied. However, research has suggested that the secreted trophic factors are more important than the process of stem cell differentiation in mediating therapeutic efficacy. The exosome, a secreted membrane vesicle, is therefore an active therapeutic factor in the process of MSC secretion (
In the present study, 3T3L1-exo was revealed to promote 3T3L1 preadipocyte osteogenic differentiation via the TGF-β pathway. Notably, the TGF-β pathway can activate RUNX2 and further induce the osteogenic differentiation of cells (
MSCs can promote TGF-β expression in murine renal tubular epithelial cells via miR-223 (
The present study confirmed that the expression of miR-223 was increased in 3T3L1-exo compared with in 3T3L1 cells. Notably, the expression levels of miR-223 were decreased in 3T3L1 preadipocytes cultured in ODM and stimulated by 3T3L1-exo compared with in cells without exosome stimulation. It may be hypothesized that 3T3L1-exo suppresses the expression of miR-223 in 3T3L1 preadipocytes through a competitive mechanism, or by another miRNA, or a factor regulated by decreased miR-223. However, these competitive mechanisms or other regulated mechanisms require further investigation In conclusion, the application of 3T3L1-exo may be useful for investigating preadipocyte-induced bone regeneration.
The authors would like to thank Dr Elizabeth Finnie for editing the English text of a draft of this manuscript.
The present study was supported by grants from the National Natural Science Foundation of China (grant no. 81700972).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
HW conceived and designed the study; WD, LS and NZ performed the experiments; and WD and LS completed the draft. All authors read and approved the manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Isolation and identification of 3T3L1-exo. (A) Electron micrograph of 3T3L1-exo. Scale bar, 100 nM. (B) Western blot analysis of exosome markers. (C) Western blot analysis of the adipogenic marker PPAR-γ. AC, differentiated 3T3L1 cells; exo/3T3L1-exo, 3T3L1 cell derived-exosomes; GRP94, heat shock protein 90β family member 1; HSP70, heat shock protein 70; PPAR-γ, peroxisome proliferator-activated receptor-γ; preAC, untreated 3T3L1 cells; TSG101, tumor susceptibility gene 101.
3T3L1-exo has no effect on 3T3L1 preadipocyte proliferation and apoptosis. (A) CCK8 was used to determine the effects of 3T3L1-exo on 3T3L1 cell proliferation (all groups, P=0.9132). (B) Fluorescence-activated cell sorting analysis was used to detect the effects of 3T3L1-exo on 3T3L1 cell apoptosis. The percentages represent the percentage of cells in each quadrant. CCK8, Cell Counting kit-8; Ctrl, control; exo/3T3L1-exo, 3T3L1 cell derived-exosomes; OD, optical density.
3T3L1-exo mediates 3T3L1 preadipocyte osteogenic differentiation. (A) ARS staining was conducted to determine the effects of 3T3L1-exo on 3T3L1 preadipocyte osteogenic differentiation. (B) Reverse transcription-quantitative polymerase chain reaction was performed to determine the effects of 3T3L1-exo on the expression of osteogenic differentiation-associated genes. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. (ODM + exo vs. ODM: osterix, P=0.0007; RUNX2, P<0.0001; Col I, P=0.0022; OCN, P=0.007; BSP, P=0.0008; ALP, P=0.0003, ctrl vs. ODM: osterix, P=0.0298; RUNX2, P=0.0006; Col I, P=0.024; OCN, P=0.05; BSP, P=0.2927; ALP, P=0.3391). ALP, alkaline phosphatase; BSP, bone sialoprotein; Col I, collagen-type I; Ctrl, control; exo/3T3L1-exo, 3T3L1 cell derived-exosomes; OCN, osteocalcin; ODM, osteogenic differentiation medium; RNX2, runt-related transcription factor 2.
3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P<0.05 vs. DMSO+ODM+exo; #P<0.05, ###P<0.001, ####P<0.0001 vs. control. (ODM + exo vs. ODM: DMSO, P=0.0204; SB431542, P=0.2204; Ctrl vs. DMSO+ODM+exo, P<0.0001; Ctrl vs. DMSO+ODM, P=0.0285; Ctrl vs. SB431542+ODM+exo, P=0.0009; Ctrl vs. SB431542+ODM, P=0.0883; DMSO+ODM+exo vs. SB431542+ODM+exo, P=0.0133; DMSO+ODM vs. SB431542+ODM, P=0.9662). Ctrl, control; DMSO, dimethyl sulfoxide; exo/3T3L1-exo, 3T3L1 cell derived-exosomes; ODM, osteogenic differentiation medium; P, phosphorylated; Smad3, SMAD family member 3.
3T3L1 cells and their exosomes differ in miRNA composition. (A) Distribution of the length of miRNA reads in 3T3L1 cells and 3T3L1-exo. (B) Differentially expressed miRNAs (log2 ratio: 3T3L1-exo/3T3L1 cells). (C) Heat maps indicating the expression of the top 20 upregulated (left) and downregulated (right) miRNAs in 3T3L1-exo compared with in 3T3L1 cells. (D) RT-qPCR analysis revealed differences in miR-223 and miR-451a expression levels in 3T3L1 cells and 3T3L1-exo *P<0.05 vs. 3T3L1 cells. (3T3L1 cells vs. 3T3L1 exo: miR-223, P=0.0185; miR-451a, P=0.0202). (E) RT-qPCR analysis was used to detect the expression levels of miR-223 in 3T3L1 preadipocytes stimulated with ODM and/or 3T3L1-exo for 48 and 72 h. ****P<0.0001 vs. ODM. (ODM + exo vs. ODM: 48 h, P<0.0001; 72 h, P<0.0001). (F) RT-qPCR was used to test the efficacy of miR-223 mimic transfection (mimics vs. ctrl: P<0.0001; mimics vs. NC: P<0.0001). (G) RT-qPCR was used to detect the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo post-transfection with miR-223 mimics. *P<0.05 vs. NC+ODM+exo; #P<0.05, ##P<0.01, ####P<0.0001 vs. control. (ODM+exo vs. ODM: NC, P=0.0200; mimics, P=0.1578; NC+ODM+exo vs. mimics+ODM+exo, P=0.0322; NC+ODM vs. mimics+ODM, P>0.9999; Ctrl vs. NC+ODM+exo, P<0.0001; Ctrl vs. NC+ODM, P=0.01; Ctrl vs. mimics+ODM+exo, P=0.0079; ctrl vs mimics+ODM, P=0.0173). Ctrl, control; exo/3T3L1-exo, 3T3L1 cell derived-exosomes; miR/miRNA, microRNA; NC, negative control; ODM, osteogenic differentiation medium; sRNA, small RNA.
Primers used for reverse transcription-quantitative polymerase chain reaction.
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
ALP | GAGCGTCATCCCAGTGGAG | TAGCGGTTACTGTAGACACCC |
OCN | GAGGGCAATAAGGTAGTGAA | CATAGATGCGTTTGTAGGC |
BSP | CAGGGAGGCAGTGACTCTTC | AGTGTGGAAAGTGTGGCGTT |
RUNX2 | ATGCTTCATTCGCCTCACAAA | GCACTCACTGACTCGGTTGG |
Osterix | GGAAAGGAGGCACAAAGAAGC | CCCCTTAGGCACTAGGAGC |
Col I | CCCTGCCTGCTTCGTGTA | TTGAGTTTGGGTTGTTCGTC |
β-actin | CGTTGACATCCGTAAAGACC | AACAGTCCGCCTAGAAGCAC |
ALP, alkaline phosphatase; BSP, bone sialoprotein; Col I, collagen-type I; OCN, osteocalcin; RNX2, runt-related transcription factor 2.