Luteolin (LTL) serves essential roles in a wide variety of biological processes. Lipopolysaccharide (LPS) can lead to myocardial hypertrophy and autophagy. However, the roles of LTL on LPS-induced cardiomyocyte hypertrophy and autophagy in rat cardiomyocytes have not yet been fully elucidated. In the present study, the morphology of cultured rat cardiomyocytes was observed under an inverted microscope. Cell viability was detected by MTT assay. α-Actinin and microtubule-associated protein 1 light chain 3 (LC3) expression levels were measured by immunofluorescence assay. In addition, the expression levels of atrial natriuretic peptide/brain natriuretic peptide (ANP/BNP), LC3, and autophagy- and Wnt signaling pathway-associated genes were analyzed by reverse transcription-quantitative polymerase chain reaction or western blot assays. The results indicated that LTL increased the cell viability of cardiomyocytes treated with LPS. LTL decreased the expression of cardiac hypertrophy associated markers (ANP and BNP). LTL decreased α-actinin and LC3 expression levels in LPS-treated cardiomyocytes. It was also demonstrated that LTL suppressed the mRNA and protein expression levels of LPS-mediated autophagy and Wnt signaling pathway-associated genes. In addition, it was demonstrated that silencing of β-catenin inhibited LPS-induced cardiomyocyte hypertrophy and the formation of autophagosomes. Thus, the present study suggested that LTL protected against LPS-induced cardiomyocyte hypertrophy and autophagy in rat cardiomyocytes.
Myocyte hypertrophy is one of the most important adaptive responses of the heart (
Lipopolysaccharide (LPS), a pathogen-associated molecular pattern, which can be found in the outer membrane of gram-negative bacteria (
Autophagy is a highly conserved lysosomal degradation pathway, of which there are three types: Chaperone-mediated autophagy, macroautophagy and microautophagy (
Luteolin (LTL) is a type of natural flavonoids, and belongs to weak acid tetrahydroxy flavonoids (
In the present study, the effect of LTL on LPS-induced viability of rat cardiomyocytes, and the effect of LTL on LPS-induced cardiomyocyte hypertrophy and the formation of autophagosomes was investigated. The regulatory effect of LTL on the expression level of β-catenin, was also investigated. In addition, β-catenin expression levels were silenced using small interference (si)RNAs in cardiomyocytes, and this effect on LPS-induced cardiomyocyte hypertrophy and formation of autophagosome was investigated.
LTL powder was obtained from Hangzhou Tiancao Technology Co., Ltd. (Hangzhou, China); the purity was >98%. LPS freeze-dried powder was purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China); the purity was >99%. The two powders were dissolved in DMSO and the solution was filtered with a 0.22 µm membrane.
All animal experiments in the present study were approved by the animal ethics committee of Jiangsu Jiankang Vocational College. Hearts from Sprague Dawley (Nanjing Better Biotechnology Co., Ltd., Nanjing, China;
siRNAs were commercially purchased from Thermo Fisher Scientific, Inc. The sequences of selected regions to be targeted by siRNAs for β-catenin were: 5′-UGGUUGCCUUGCUCAACAATT-3′ (sense), 5′-UUGUUGAGCAAGGCAACCATT-3′ (antisense). Cells (1×105 cells/ml) were transfected with 50 nM scramble siRNA (Negative control, NC) or β-catenin-siRNA by Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot assays were performed to assess the transfection efficiency. Cells transfected into β-catenin-siRNA were cultured for 24 h and then used for subsequent experiments.
Cardiomyocytes (2.5×103 cells/ml) were treated with 0.1% PBS (blank control group), 10% FBS (negative group, NC), LPS (100 ng/ml), LTL1 (50 mg/ml) and LPS (100 ng/ml), and LTL 2 (100 mg/ml) and LPS (100 ng/ml) for 8 h at 37°C. Subsequently, cells were used to detect the cell viability, the expression levels of α-actinin and LC3, and autophagy and Wnt signaling pathway-associated gene expression. Cardiomyocytes were treated with PBS, FBS, LPS, β-catenin siRNAs and LPS, and β-catenin siRNAs + LTL1 + LPS.
Total RNA was extracted from the treated cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. First-strand cDNA was synthesized using Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc.). The mRNA expression levels were determined by qPCR using SYBR GREEN PCR Master Mix (Applied Biosystem; Thermo Fisher Scientific Inc.) and assayed by ABI 7500 Real-time PCR system (Applied Biosystems; Thermo Fisher Scientific Inc.). The thermocycling conditions were set as follows: 10 min pretreatment at 95°C for 10 min, denaturation at 95°C for 15 sec, annealing at 61°C for 30 sec, extension at 72°C for 30 sec (40 cycles) and finally a 7-min extension at 72°C. The data were analyzed using 2−∆∆Cq method (
Cells (5×105 cells/ml) were lysed on ice in radioimmunoprecipitation assay buffer (cat. no. 8990; Pierce; Thermo Fisher Scientific, Inc.) buffer containing protease inhibitor cocktail (Thermo Fisher Scientific, Inc.). Pierce bicinchoninic Protein Assay kit (Thermo Fisher Scientific, Inc.) was applied to analyze the concentration of proteins. Total protein (30 µg) was separated by 10% SDS-PAGE and then transferred onto polyvinylidene fluoride membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were blocked with 5% skimmed milk and incubated with primary antibody overnight at 4°C. Next day, the membranes were as required incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:2,000; cat. no. sc-2004; Santa Cruz Biotechnology, Inc., Dallas, TX. USA) or chicken anti-goat lgG-HRP (1:1,000; cat. no. sc-516086; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) for 2 h at room temperature. The protein expression levels were measured using an enhanced chemiluminescence system (Amersham Pharmacia Biotech; GE Healthcare, Chicago, IL, USA). The results were analyzed by Image Lab Software version 4.1 (Bio-Rad Laboratories, Inc.). Primary antibodies used were as follows: Anti-GAPDH (1:1,000; cat. no. sc-20358; Santa Cruz Biotechnology); anti-LC3 [two forms: LC3I and LC3II (
MTT assay was carried out to determine the cell viability. The treated cardiomyocytes (2×103 cells/well) were first seeded into 96-well plates and then cultured in cell incubators for 6 h at 37°C. After being cultured, 20 µl solution MTT (5 mg/ml, cat. no. M-2128, Sigma-Aldrich; Merck KGaA) was added. After 4 h of incubation at 37°C, 10 µl DMSO was added to dissolve the formazan product by incubating for 10 min at room temperature. Subsequently, the plates were measured by a microplate reader at 490 nm absorbance. Each condition was determined in quintuplicate from three independent experiments.
The treated cardiomyocytes (3×104 cells/ml) were washed with PBS gently and then fixed with 4% paraformaldehyde at 4°C for 20 min. After blocking with 10% goat serum (Gibco™; cat. no. 16210064; Thermo Fisher Scientific, Inc.), cells were incubated with primary antibodies anti-α-actinin (1:1,000; cat. no. ab9465; Abcam) and anti-LC3 (1 µg/ml; cat. no. ab48394; Abcam) overnight at 4°C. After being washed, cells were incubated with a fluorescence-conjugated secondary antibody (4 µg/ml; Alexa-Fluor® 594 goat anti-rabbit antibody IgG; A-11037; Thermo Fisher Scientific, Inc.) for 1 h at room temperature. Nuclei were counterstained with 4′-6-diamidino-2-phenylindole (DAPI; 1:1,000; Thermo Fisher Scientific, Inc.) for 15 min at 37°C, and the images were then obtained using a fluorescence microscope (Olympus Corporation, Tokyo, Japan). The cell surface area (green of fluorescence staining) was calculated by formula (axb)/2 (a: The longest distance through the nucleus; b: The shortest distance through the nucleus) and analyzed by Image Pro-Plus 6.1 software (National Institutes of Health, Bethesda, MD, USA).
All experiments were performed at least three times. Numerical data are shown as the mean ± standard error. Statistical analysis was performed using SPSS 13.0 (SPSS, Inc., Chicago, IL, USA) and statistical significance was assessed by analysis of variance with Dunnet's post-test comparison. P<0.05 was considered to indicate a statistically significant difference.
To investigate the potential biological roles of LTL in cardiomyocytes, myocardial cells were isolated from newborn rats. The morphology of the cultured rat cardiomyocytes was observed with a microscope and most cells were typical myocardial cells (
In order to prove the role of LTL on cardiomyocyte hypertrophy and formation of autophagosomes, cultured cardiomyocytes were treated with PBS, FBS, LPS, LTL1 and LPS, and LTL2 and LPS for 8 h. The expression levels of ANP and BNP were increased by LPS compared with the control (P<0.01;
In addition, the effects produced by LTL on autophagy-associated genes were further analyzed. Cardiomyocytes were treated with PBS, FBS, LPS, LTL1 + LPS, or LTL2 + LPS for 8 h. Expression levels of LC3 and autophagy-associated genes (Atg12, Atg4b, Vps34 and Bnip1) were measured by RT-qPCR and western blot assays. Results demonstrated that LC3 expression levels were notably upregulated in the LPS group in comparison with that of the NC group, and that LC3II expression levels were downregulated and LC3I expression was upregulated in both LTL + LPS groups, compared with the LPS alone group (P<0.05;
Wnt/β-catenin signaling pathway serves a conservative signaling pathway, and exists in various organisms (
As shown in previous results, LTL decreased LPS-mediated Wnt signaling pathway-associated genes. The knockdown efficiency of β-catenin in cardiomyocytes using RT-qPCR and western blot assays was established. The results indicated that the mRNA expression levels of β-catenin were decreased in si-β-catenin group compared with that of control group (P<0.05;
To further investigate the exact roles of β-catenin in LPS-induced cardiomyocyte hypertrophy and the formation of autophagosomes in them, cardiomyocytes were treated with PBS, FBS, LPS, β-catenin siRNAs + LPS, and β-catenin siRNAs + LTL1 + LPS for 8 h. Immunofluorescence staining was then performed to measure the expression levels of α-actinin and LC3. The results demonstrated that LPS induced α-actinin expression levels, which was then reversed by silencing β-catenin by siRNA (From 7.5–5.5 µm2) and by siβ-catenin with LTL1 co-treatment (From 7.5–5.0 µm2). This may suggest that silencing of β-catenin and siβ-catenin with LTL1 co-treatment suppressed LPS-induced cardiomyocyte hypertrophy (P<0.05;
Lipopolysaccharide (LPS) is a category of glycolipids composed of two distinct regions, and LPS can lead to endotoxemia induced by infections with gram-negative bacteria (
Autophagy, as a cellular degradation system, mainly participates in removing redundancy or damaged organelles, and longevous proteins and cell components (
LTL can reduce the mortality of coronary heart disease and has a protective effect on cardiovascular disease (
Wnt signaling pathway largely serves essential roles in various biological processes (
In summary, the data obtained in the present study indicated that LTL increased the viability of cardiomyocytes treated by LPS, and that LTL inhibited cardiomyocyte hypertrophy and the formation of autophagosomes of rat cardiomyocytes induced by LPS. LTL decreased Wnt signaling pathway mediated by LPS, and silencing of β-catenin inhibited LPS-induced cardiomyocyte hypertrophy and the formation of autophagosomes. Therefore, it may be concluded that LTL may contribute to LPS-induced cardiomyocyte hypertrophy and autophagy in cardiomyocytes by regulating β-catenin, but this needs to be verified.
Not applicable.
The present study was supported by State Traditional Chinese Medicine Base Construction Project No. JDZX2015143 under State Administration of Traditional Chinese Medicine.
The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.
XL designed the study, JL and JW performed the experiments, DZ and JW analyzed the data.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
LTL increases the viability of rat cardiomyocytes treated with LPS. Cells were divided into five groups, including PBS (control group), 10% fetal bovine serum (NC), LPS (100 ng/ml), LTL1 (50 mg/ml) + LPS (100 ng/ml), and LTL2 (100 mg/ml) + LPS (100 ng/ml) for 8 h. (A) The morphology of the cultured rat cardiomyocytes (24 h). (B) Cell viability was detected by the MTT assay. (C) Expression levels of ANP and BNP was determined by reverse transcription-quantitative polymerase chain reaction. *P<0.05 and **P<0.01 vs. NC; +P<0.05 vs. LPS. ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; LC3, microtubule-associated protein 1 light chain 3; LPS, lipopolysaccharide; LTL, luteolin; NC, negative control.
LTL suppresses LPS-induced cardiomyocyte hypertrophy and formation of autophagosomes. (A) The expression levels of α-actinin (a cardiomyocyte specific marker and a hypertrophic marker gene) were measured by immunofluorescence staining in the treated cardiomyocytes; nuclei were stained with DAPI. The Myocyte area (µm2) was calculated by formula (axb)/2 (a: The longest distance through the nucleus; b: The shortest distance through the nucleus) and analyzed by Image Pro-Plus 6.1 software after anti-α-actinin staining (green). (B) The expression levels of LC3 (green) were measured by immunofluorescence assay in the treated cardiomyocytes; nuclei were stained with DAPI. By specific labeling of autophagosome membranes (LC3II) and the cytoplasmic labeling (LC3I) and the amount of LC3 was quantified by densitometry. **P<0.01 and ***P<0.001 vs. NC; +P<0.05 and ++P<0.01 vs. LPS. LC3, microtubule-associated protein 1 light chain 3; LPS, lipopolysaccharide; LTL, luteolin; NC, negative control.
LTL decreases LPS-mediated autophagy- and Wnt signaling pathway-associated gene expression levels. (A) RT-qPCR and (B) western blot assays were performed to detect the LC3 mRNA and LC3I and II protein expression levels, respectively. (C and D) Autophagy-associated gene expression levels were analyzed by RT-qPCR and western blot assays. *P<0.05, **P<0.01 and ***P<0.001 vs. NC; ++P<0.01 and +++P<0.001 vs. LPS. Atg, autophagy-related 4b cysteine peptidase; Bnip, B cell lymphoma l2 interacting protein; LC3, microtubule-associated protein 1 light chain 3; LPS, lipopolysaccharide; LTL, luteolin; NC, negative control; RT-qPCR, reverse transcription-quantitative polymerase chain reaction. LTL decreases LPS-mediated autophagy- and Wnt signaling pathway-associated gene expression levels. (E and F) Wnt signal pathway associated genes expression levels were detected by RT-qPCR and western blot assays. *P<0.05, **P<0.01 and ***P<0.001 vs. NC; ++P<0.01 and +++P<0.001 vs. LPS. Atg, autophagy-related 4b cysteine peptidase; Bnip, B cell lymphoma l2 interacting protein; LC3, microtubule-associated protein 1 light chain 3; LPS, lipopolysaccharide; LTL, luteolin; NC, negative control; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
β-Catenin expression is silenced using siRNA in cardiomyocytes. (A) Reverse transcription-quantitative polymerase chain reaction and (B) western blot assays were performed to detect the knockdown efficiency of β-catenin siRNA. (C) Quantification of the western blot analysis from (B). **P<0.01 and ***P<0.001 vs. NC. NC, normal control; siRNA, small interfering RNA.
Silencing of β-catenin inhibits LPS-induced cardiomyocyte hypertrophy and formation of autophagosome. (A) Expression levels of α-actinin (a cardiomyocyte specific marker and a hypertrophic marker gene) were measured by immunofluorescence staining; nuclei were stained with DAPI. The myocyte area was calculated by formula (axb)/2 (a: The longest distance through the nucleus; b: the shortest distance through the nucleus) and analyzed by Image Pro-Plus 6.1 software after anti-α-actinin staining (green). (B) LC3 expression levels were measured by immunofluorescence assay; nuclei were stained with DAPI. By specific labeling of autophagosome membranes (LC3II) and the cytoplasmic labeling (LC3I) and the amount of LC3 was quantified by densitometry. ***P<0.001 vs. NC; +P<0.05 vs. LPS. LC3, microtubule-associated protein 1 light chain 3; LPS, lipopolysaccharide; LTL, luteolin; NC, normal control; siRNA, small interfering RNA.
Primer sequences for the reverse transcription-quantitative polymerase chain reaction.
Gene | Primer sequences (5′-3′) |
---|---|
GAPDH | F: TATGATGATATCAAGAGGGTAGT |
R: TGTATCCAAACTCATTGTCATAC | |
LC3 | F: GAGAAGCAGCTTCCTGTTCTGG |
R: GTGTCCGTTCACCAACAGGAAG | |
BNP | F: TCGGCGCAGTCAGTCGCTTG |
R: CGCAGGCAGAGTCAGAAGCCG | |
ANP | F: TTCTCCATCACCAAGGGCTT |
R: GACCTCATCTTCTACCGGCA | |
Atg12 | F: CAGAAACAGCCATCCCAGAG |
R: GCCTTCAGCAGGATGTCAAT | |
Atg4b | F: TATGATACTCTCCGGTTTGCTGA |
R: GTTCCCCCAATAGCTGGAAAG | |
Vps34 | F: TGGAACTGGAATGAATGGC |
R: GCATCCCTTGGCGAAAC | |
Bnip1 | F: GGAGGTGGAGGTTGTGATGA |
R: TATGGCAGCCCCTAGACATG | |
Wnt2 | F: GGATGCCAGAGCCCTGATGAATCTT |
R: GCCAGCCAGCATGTCCTGAGAGTA | |
β-catenin | F: GACTTCACCTGACAGATCCAAG |
R: AGCTGAACAAGAGTCCCAAG | |
GSK3β | F: CTGGGACGACATGGAGAAAA |
R: AAGGAAGGCTGGAAGAGTGC |
ANP, atrial natriuretic peptide; Atg, autophagy-related 4b cysteine peptidase; Bnip, B cell lymphoma 2 interacting protein; BNP, brain natriuretic peptide; F, forward; GSK3β, glycogen synthase kinase 3β; LC3, microtubule-associated protein 1 light chain 3; R, reverse; Vps, vacuolar protein sorting-associated protein.