Adult patients were screened if they had a CKD stage between 1–5, according to the Kidney Disease Outcomes Quality Initiative (KDOQI) criteria published in January 2012 (27). According to the KDOQI criteria, patients are classified into five stages based on their estimated GFR (eGFR). The eGFR was determined by the CKD Epidemiology Collaboration creatinine equation (28). A total of 115 adults were screened, of whom three were excluded from the study as they were diagnosed with acute kidney injury. Finally, 112 patients (77 men and 35 women; 31–88 years, mean age 64.5±12.7 years) were enrolled and underwent a 6-year follow-up between January 2010 and December 2015 at Huashan Hospital, Fudan University, Shanghai, China.

Blood samples for laboratory measurements were obtained at the time of enrolment and at 1.5-years follow-up. The concentration of serum soluble α-KL was determined using an ELISA kits obtained from Immuno-Biological Laboratories Co., Ltd. (cat. no. 27998; Fujioka, Japan), according to the manufacturer's instructions. ∆ aldosterone was calculated using the concentration of aldosterone at baseline and at 1.5-years follow-up (∆value=value at the 1.5-year follow-up-value at the baseline).

The present study was approved by the Ethics Committee of Huashan Hospital, Fudan University (Shanghai, China). All provided written informed consent for participation and the study was conducted in accordance with the Declaration of Helsinki.

A total of 20 adult C57 male mice at 7–8 weeks of age and ~20 g weight, were obtained from the Animal Research Center, Fudan University (Shanghai, China). They were housed at 4 mice per cage and maintained for 14 days in a temperature-controlled environment under a 12-h light/dark cycle with ad libitum access to food and water. The mice were uninephrectomized. Following a 2 week recovery period, an ALZET^® osmotic pump (model no. 2002; DURECT Corporation, Cupertino, CA, USA) was implanted subcutaneously (29). Subsequently, mice were divided into three treatment groups: Group 1, vehicle (0.5% ethanol, subcutaneously) (n=4) as the WT group; Group 2, vehicle (subcutaneously) + 1% NaCl in drinking water (n=8) as the low aldosterone group; Group 3, 0.75 µg/h aldosterone (subcutaneously) + 1% NaCl in drinking water (n=8) as the high aldosterone group (29). Mice were treated for 2 weeks. The study was approved by the Ethics Committee of Fudan University (reference no. 201702069S; Shanghai, China). All experiments conformed to standards set by the Laboratory Animal Regulation of the State Scientific and Technological Commission (Shanghai Lab. Animal Research Center).

The concentration of serum aldosterone was ascertained using a chemiluminescent immunoassay obtained from Shenzhen New Industries Biomedical Engineering Co. Ltd. Shenzhen, China (cat. no. 0525-2007).

Briefly, fresh kidney tissues were fixed in 4% paraformaldehyde (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 30 min at room temperature. Then, the tissue was dehydrated using graded ethanol (70, 80, 90 and 100%), embedded in paraffin, sectioned (6-µm thickness), and immersed in xylene for dewaxing. The sections were stained with H&E (Sigma-Aldrich; Merck KGaA). The rehydrated sections were stained in hematoxylin solution for 30 min at room temperature and washed in tap water for 5 min until the sections turned blue. The sections were differentiated in 70% ethanol containing 1% HCl for 5 seconds and then washed for 5 min in tap water until blue. The sections were then stained in eosin solution for 10 min. The sections were cleared with xylene and sealed with neutral resin (both Sigma-Aldrich; Merck KGaA). The sections were observed under a light microscope at magnification, ×100-400 and three fields of view were observed.

Total kidney RNA was extracted from each group of mice using TRIzol^® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The RNA was processed using DNase I (Sigma-Aldrich; Merck KGaA) and reverse transcribed to cDNA using the ReverTra Ace-α-^® kit [Toyobo (Shanghai) Co., Ltd., Shanghai, China]. The RNA and primer Oligo dt were heated in a 70°C heat block for 5 min then immediately chilled in ice water for ≥5 min, then centrifuged at 15,725 × g for 10 sec in a microcentrifuge at 4°C before being stored on ice until reverse transcription mix was added. qPCR was performed using a SYBR^® Green Realtime PCR Master Mix [Toyobo (Shanghai) Co., Ltd.] on a MasterCycle RealPlex⁴ real-time PCR detection system (Eppendorf, Hamburg, Germany). The sequences of forward and reverse primers of Klotho was 5′GAGTGGCATAGGGGCTACA and 5′GGCTGGTTTTCAGGTAAAGG, respectively. The sequences of forward and reverse primers of fibronectin 1 was 5′AGTGGAAGTGTGAGCGACAT and 5′GTGAGTCTGCGGTTGGTAAAT, respectively. The sequences of forward and reverse primers of 18S was 5′CAGCCACCCGAGATTGAGCA and 5′TAGTAGCGACGGGCGGTGTG, respectively. The thermocycling conditions were as follows: 40 cycles of denaturation at 95°C for 15 sec, annealing at 58°C for 30 sec and extension at 72°C for 42 sec. The relative expression levels of the gene were determined by the 2^−ΔΔCq method (30). The mRNA expression levels were normalized to the internal reference gene, 18S ribosomal RNA.

Briefly, fresh kidney tissues were fixed in 4% paraformaldehyde (Sigma-Aldrich; Merck KGaA) for 30 min at room temperature. Then, the tissue was dehydrated in an ethanol gradient (70, 80, 90 and 100%), embedded in paraffin, sectioned (6-µm thickness) and immersed in xylene for dewaxing. The sections were blocked using an immunohistochemical blocking solution (Beyotime Institute of Biotechnology, Haimen, China) at 37°C for 30 min. After the blocking solution was discarded, the samples were washed in washing buffer (Beyotime Institute of Biotechnology) three times, 5 min each at room temperature. The samples were incubated with antibodies (rabbit anti-mouse HDAC1; cat. no. 34589 and rabbit anti-mouse H3K9Ac; cat. no. 9927, 1:200; Cell Signaling Technology, Inc., Danvers, MA, USA) at 37°C for 45 min. The horseradish peroxidase-conjugated secondary antibody (cat. no. sc-2768; 1:200; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) was added and the sections were incubated for 60 min at room temperature. Finally, a VECTASTAIN Elite ABC kit (cat. no. PK-6100; Vector Laboratories, Inc., Burlingame, CA, USA) was used for the color reaction. Meanwhile, PBS (pH 7.4) was used as a negative control in the place of the first antibody. After the antibody was discarded, the samples were washed in washing buffer three times, 5 min each at room temperature. Finally, the samples were mounted in neutral resin (Sigma-Aldrich; Merck KGaA).

Masson's trichrome staining was used at room temperature for 10 min to detect collagen fibers in the tissues: Collagen fibers were stained blue, nuclei are stained dark brown and background is stained red. The sections were observed under a light microscope at magnification, ×100-400 and three fields of view were observed.

Total protein was extracted using NP-40 (Nonidet P-40) lysis buffer over ice and the protein concentration determined with a BCA Protein Assay kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). Protein at 30 µg/lane protein was separated by 12% SDS-PAGE gels and transferred onto polyvinylidene fluoride membranes. The membranes were blocked using 5% bovine serum albumin (cat. no. 37520; Thermo Fisher Scientific, Inc.) in Tris-buffered saline with Tween-20 or with Triton X-100 and then incubated with primary antibodies overnight at 4°C. The antibodies of HDAC1 and H3K9Ac were the same as used for immunohistochemical staining, dilution 1:500 together with rabbit anti-mouse klotho antibody (cat. no. ab154163; 1:1,000; Abcam, Cambridge, MA, USA). Subsequently, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (goat anti-rabbit IgG; cat. no. sc-2357; 1:200; Santa Cruz Biotechnology, Inc.; rabbit anti-mouse β-actin antibody; cat. no. ab8227; 1:2,000; Abcam) for 1 h in 37°C. The membranes were washed to remove unbound antibodies and proteins were detected using ECL Immobilon Western Chemiluminescent HRP Substrate (cat. no. WBKLS0500; EMD Millipore, Billerica, MA, USA). The protein bands were visualized using a Kodak XAR-5 film chemiluminescence imaging system (Sigma-Aldrich; Merck KGaA). The protein levels were normalized to the reference protein β-actin.

ChIP reactions were performed using the EZ-ChIP^™ kit (EMD Millipore, Billerica, MA, USA), according to the manufacturer's instructions. Briefly, the mouse kidney samples were fixed in 1% paraformaldehyde for 30 min at 37°C and then 125 mM glycine was added for 10 min at room temperature to terminate the cross-linking. Ultrasonication was used to fragment the DNA into 200–1,000 bp chromatin fragments. The sonicator was adjusted to 30% intensity and 2 mm pulse wave, 50 watts of power. All samples received 3 sonications for 10 sec each, 15 sec apart. The chromatin fragments were incubated overnight at 4°C with primary antibodies (Rabbit anti-mouse H3K9Ac; cat. no. 9649; 1:100; Cell Signaling Technology, Inc.). Then, Pierce^™ Protein A/G Plus Agarose (Thermo Fisher Scientific, Inc.) was added to the solution to obtain immunoprecipitated chromatin for PCR analysis. The PCR conditions were as follows: Denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec and extension at 72°C for 30 sec for 30 cycles. The ChIP PCR KL promoter primers were as follows: Forward, 5′-CTCAGGATGGAGGCCACAGG-3′ and reverse, 5′-CACAGCAGGGGTCATAGGGA-3′. The amplified product was visualized on a 1.2% agarose gel. The ChIP PCR product was on the KL promoter region from −215 to −134 bp.

Statistical analyses were performed using GraphPad Prism software version 5.0 (GraphPad Software, Inc., La Jolla, CA, USA) or SPSS software version 17.0 (SPSS, Inc., Chicago, IL, USA). The data are presented as the mean ± standard error. Differences among multiple groups were evaluated using one-way analysis of variance and differences between two groups were evaluated using Student's t test. Correlation between two continuous variables was determined using Pearson's correlation coefficient. P<0.05 was considered to indicate a statistically significant difference.

Blood samples were collected from 112 patients with CKD, and the serum KL and aldosterone concentrations were determined. Correlation analysis indicated that the serum ∆ aldosterone at 1.5-years follow-up was significantly negatively correlated with serum KL (R=−0.237, P<0.01; Fig. 1A).

In the aldosterone-induced CKD mouse model, aldosterone levels in the peripheral blood of mice in the high aldosterone group (34,702.01±4,307.62 pmol/l) were significantly higher compared with the low aldosterone (462.19±148.87 pmol/l) and wild-type (WT) groups (656.11±32.76 pmol/l; Fig. 1B).

qPCR measurement of KL and Fn1 demonstrated that KL mRNA expression levels were significantly lower, whereas Fn1 expression levels were significantly higher in the renal tubules of high aldosterone mice compared with low aldosterone and WT mice (Fig. 1C). The western blot results were consistent and revealed a significantly lower KL protein expression in the kidneys of high aldosterone mice compared with low aldosterone and WT mice (Fig. 1D). These results suggested that KL expression was inversely proportional to aldosterone release and renal fibrosis.

Immunohistochemical staining revealed that HDAC1 expression was absent in the distal convoluted tubules of WT mice and HDAC1 expression was weak in low aldosterone mice. However, HDAC1 expression was markedly increased in high aldosterone mice. In addition, H3K9Ac was strongly expressed in the distal convoluted tubules of WT and low aldosterone mice, whereas H3K9Ac staining was absent in high aldosterone mice (Fig. 2). Western blotting demonstrated that HDAC1 was highly expressed and H3K9Ac was rarely modified in the kidneys of high aldosterone mice (Fig. 3A). The results indicated that high aldosterone levels induced renal injury, resulting in high HDAC1 expression in the distal convoluted tubules and H3K9 deacetylation.

To determine the transcriptional activation status between KL and H3K9Ac, ChIP-PCR was used to confirm the binding of the promoter region of KL gene to H3K9Ac site. The binding site of the KL promoter region is between 215 and −134 bp (Fig. 3B). The results showed that the binding product of KL promoter was obtained in the H3K9Ac site in the distal convoluted tubules of normal mice and low aldosterone mice (Fig. 3C). However, in high aldosterone mice there was rarely a binding product of KL promoter at the H3K9Ac site. Thus, the results demonstrated that high aldosterone inhibits the acetylation of the H3K9 site, leading to its inability to bind to the KL promoter and ultimately inhibits the transcription of the KL gene.