MicroRNA-233-3p (miR-223-3p) is considered an important cancer-associated marker. The NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome represents a novel potential target for the treatment of breast cancer. Therefore, it was hypothesized that miR-223-3p may affect tumor growth and immunosuppression in breast cancer by inhibiting the NLRP3 inflammasome. In the present study, an increased expression level of NLRP3 was detected in three breast cancer cell lines compared with normal mammary epithelial cells (HMEC). Suppressing the expression of NLRP3 in MCF-7 cell lines increased the apoptotic rate of breast cancer cells and reduced the proliferative capacity. NLRP3 was identified to be a direct target of miR-233-3p using a luciferase assay. In addition, miR-233-3p mimics inhibited the NLRP3-dependent processes in cancer cells by suppressing the NLRP3 expression level and the protein expression levels of its downstream factors, including PYD and CARD domain containing protein, interleukin-1β and interleukin-18.
Breast cancer is one of the most common types of cancer, accounting for 7–10% of systemic malignancies, and is a serious health threat to women worldwide (
Inflammasomes are multiprotein complexes regulating various inflammatory factors, including interleukin-1β (IL-1β) and interleukin-18 (IL-18). IL-18 induces programmed cell death protein 1-dependent immunosuppression in cancer (
MicroRNAs (miRNAs) regulate a variety of important biological processes in cells, including cell proliferation, differentiation and invasion (
The present study suggested that miR-233 suppressed the growth of breast cancer cells via a mechanism associated with the inactivation of the NLRP3 inflammasome. The present results provided novel insight into the molecular functions of miR-233 in regulating the NLRP3 inflammasome in breast cancer cells.
HMEC, MDA-MB231, MCF-7 and SKBR3 cell lines were purchased from the Type Culture Collection of The Chinese Academy of Sciences (Bena Culture Collection, Shanghai, China). MDA-MB231 and SKBR3 cell lines were maintained in RPMI-1640 medium (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 100 mg/ml streptomycin and 100 U/ml penicillin. MCF-7 cell lines and HMEC cells were cultured in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Inc.) containing 10% FBS, 100 mg/ml streptomycin and 100 U/ml penicillin. Cells were passaged with PBS (Sigma-Aldrich; Merck KGaA) and 0.02% EDTA/0.5% trypsin (GE Healthcare, Chicago, IL, USA) every 3 days. All cells were cultured with 5% CO2 at 37°C until further experiments were performed.
The short hairpin (sh)-NLRP3, miRNA mimics, inhibitors and the scrambled negative control oligonucleotides were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China) and 1,000 ng/µl used for the transfection of MCF-7 cells with Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Transfection was performed with Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. In total, 2×104 cells/well were seeded into six wells and each sample was transfected with 0.2 mg RNA. Following transfection, cells were incubated at 37°C with 5% CO2 for 24 or 48 h.
miRNA was extracted from cells using the miRNeasy FFPE kit (Qiagen China Co., Ltd., Shanghai, China). Primers for miR-233 (cat. no. HmiRQP0339; ATATAGCATCTTTCTGTCTCGCCCATCCCGTTGCTCCAATATTCTAACAACAAGTGATTATTGAGCAATGCGCATGTGCGGGATAGACTGATGGCTGC) were obtained from GeneCopoeia, Inc. (Rockville, MD, USA). NLRP3 primers were forward, 5′-AGACCTCCAAGACCACTAC-3′ and reverse, 5′-ACATAGCAGCGAAGAACTC-3′. Total RNA was extracted from the cells using RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. The extracted RNA was reverse transcribed into cDNA using the ThermoScript™ RT-PCR system at 40°C for 2 h (Invitrogen; Thermo Fisher Scientific, Inc.). RT-qPCR was performed using the 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using appropriate primers and the fluorescent dye SYBR Green (Takara Biotechnology Co., Ltd., Dalian, China). For quantification of mature miRNA, cDNA was generated using specific stem-loop universal primers. PCR reaction mixtures were set up in a total volume of 20 µl. Standard PCR settings (95°C for 30 sec, 40 cycles of 95°C for 5 sec and 60°C for 34 sec, followed by a dissociation stage for 15 sec at 95°C, 1 min at 60°C and 15 sec at 95°C) were used. All samples were run in duplicates. GAPDH was selected as the normalization control gene. The same RT-qPCR protocol was used for all the genes and miRNA analyzed. Results are expressed as fold change with respect to the experimental control. Quantitation was according to R=(1+E1)∆Ct1 (Control-Sample)/(1+E2)∆Ct2 (Control-Sample) method (
Cells and tissues were homogenized in radioimmunoprecipitation assay buffer (Thermo Fisher Scientific, Inc.). The protein concentration was determined using a Bicinchoninic Acid protein assay kit (Thermo Fisher Scientific, Inc.), and 50 µg protein was loaded per lane with 5% concentrated SDS gels and 15% separating gel. Following electrophoresis, the gel was transferred onto a 0.45 µm polyvinylidene fluoride membrane (Merck KGaA). Following transfer, the membranes were blocked for 2 h with 5% nonfat dry milk at room tempreture. Subsequently, the membranes were incubated overnight at 4°C with anti-NLRP3 (15101; 1:500), anti-proliferation marker protein Ki67 (9129; 1:1,000; Ki67; both CST Biological Reagents Co., Ltd., Shanghai, China), anti-vascular endothelial growth factor (VEGF; ab32152; 1:500 Abcam, Cambridge, UK), anti-PYD and CARD domain-containing protein (ASC; sc-271054; 1:500; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), anti-IL-1β (ab200478; 1:500), anti-IL-18 (ab71495; 1:500; both Abcam) and anti-GAPDH (35174.; 1:1,000) primary antibodies, followed by incubation with secondary antibody conjugated to horseradish peroxidase (7074; 1:1,000; both CST Biological Reagents Co., Ltd.) at room tempreture for 2 h. Following washing with TBS, proteins were visualized using enhanced chemiluminescence reagents Rabbit IgG (Pierce; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. ImageJ (version number: 1.4.3.67; National Institutes of Health, Bethesda, MD, USA) was used for densiometric analysis.
Coverslips were soaked in 70% ethanol for 5 min, the cells were washed three times with 0.9% NaCl and the coverslips were placed in 6-well plates and incubated at 37°C with 5% CO2 overnight. Cells were stimulated to undergo apoptosis by 100 µM H2O2 for 1 h. Subsequently, the culture solution was discarded and 0.5 ml 4% paraformaldehyde fixative solution was added for 10 min at 37°C. The fixative was removed and cells were washed twice with 0.9% NaCl for 3 min, and the washing solution was discarded. A total of 0.5 ml Hoechst 33258 staining solution was added and cells were stained for 5 min at 37°C. The slides were sealed with antifluorescence quenching sealant, and imaged using fluorescence microscopy for 20 fields of view and the analysis were used for Image J version 1.8.0 (National Institutes of Health).
To analyze cell migration, 2×105 cells were seeded in six-well plates in triplicate. A Transwell chamber was placed into the culture plate, with the upper chamber containing the upper culture medium (DMEM) and the lower chamber containing the lower culture medium (DMEM). The upper and lower culture media were separated by a polycarbonate membrane. Following 7 days, cells were plated in the upper chamber and the growth and migration of cells in the lower culture medium. The cells were stained with 0.1% crystal violet for 20 min at room temperature and the unmigrated cells in the upper layer were gently wiped off with a cotton swab and washed 3 times with PBS and using a light microscope with magnification, ×10. All experiments were performed in triplicates and error bars indicate the standard deviation.
A cell proliferation assay was performed using a Cell Counting kit-8 (CCK-8). A total of 2×105 cells were plated into 96-well culture plates. Following 24 h incubation, CCK-8 solution was added to each well and incubated for 4 h (1 mg/ml; Sigma-Aldrich; Merck KGaA) at 37°C with 5% CO2. The absorbance was measured at 450 nm. Each experiment was performed at least three times, each with triplicate samples.
Association between miR-223 and NLRP3 was predicted using the online software Targetscan (
The animal experiments in the present study were approved by The Animal Care and Research Committee of Beijing Tiantan Hospital (Beijing, China). All experiments were performed in compliance with relevant laws and guidelines. All experiments were conducted following the institutional guidelines of Beijing Tiantan Hospital.
The total of 100 female mice were purchased from The Institute of Zoology, Chinese Academy of Medical Sciences (Bejing, China). The animals were 8 weeks old and 20–22 g in weight. The mice were kept in clean rooms at a temperature of ~25°C with a humidity of 75%, 12-h light/dark cycle and food and water
Sections of 5 µm in thickness were prepared using tissue blocks embedded in paraffin and fixed using 4% formaldehyde overnight at room tempreture, followed by deparaffinization and hydration using xylene and graded alcohol series. The sections were treated with a sodium citrate buffer in a microwave for antigen retrieval and blocked using normal goat serum. Then washed 3 times with PBS for 5 min each time. Subsequently, sections were stained using rabbit anti-terminal deoxynucleotidyl transferase (1:100), anti-Ki67 (1:100) or anti-VEGF (1:100; all Abcam) overnight at 4°C, and subsequently incubated with a biotinylated goat anti-rabbit immunoglobulin G secondary antibody for 1 h, followed by staining with an avidin-biotin peroxidase complex (GeneTex, Inc., Irvine, CA, USA).
Blood samples were collected by enucleation. Subsequently, samples were kept at room temperature for 2 h and centrifuged at 2,000 × g for 30 min with 25°C. Subsequently, serum was transferred into 1.5 ml polypropylene tubes, and stored at −20°C. Protein expression levels of IL-1β, IL-18 and IL-10 in the serum were determined using an ELISA kit (Yinggong Corporation, Shanghai, China) according to the manufacturer's protocol, at 450 nm.
SPSS (version 22.0; IBM Corp., Armonk, NY, USA) software was used for statistical analysis. Data obtained from experiments using cultured cells are presented as the mean ± standard deviation. Statistical analysis of normal distribution was performed on two independent samples. Differential expression of miRNAs was detected by t-test or one-way analysis of variance (ANOVA). Survival curves were analyzed using Kaplan-Meier method and log-rank test. One-way analysis of variance was followed by a post hoc test for difference value calculation, and Mann-Whitney U tests were performed to determine statistical differences in viability between miR-233- and scramble-transfected cells in case of non-normal distributions. Qualitative data were representative of more than three independent experiments, with each performed in triplicate. P<0.05 was considered to indicate a statistically significant difference.
NLRP3 expression levels were measured in three breast cancer cell lines (MDA-MB231, MCF-7 and SKBR3) and normal mammary epithelial cells (HMEC). An increase in the NLRP3 expression level was observed in the breast cancer cells compared with HMEC (
Subsequently, the effects of sh-NLRP3 on cell function were investigated in breast cancer cells. The percentage of apoptotic cells following sh-NLRP3 transfection was significantly higher compared with the MCF-7 control group (
The physical association between miR-223 and NLRP3 was predicted by online software Targetscan. The expression of miR-223 was detected using RT-qPCR in MCF-7 cells transfected with miR-223 mimics or miR-223 inhibitor. The present results demonstrated that miR-223 was significantly increased in the miR-223 mimics group and was significantly decreased following miR-223 inhibitor transfection compared with the MCF-7 control (
To further investigate the association between miR-233 and NLRP3 in human breast cancer cells, NLRP3 was overexpressed by transfecting cells with a pcDNA vector containing NLRP3. The present results suggested that NLRP3 promoteed the growth of breast cancer cells, while miR-233 could inhibit its proliferation at the tissue level (
To investigate the inhibitory effects of miR-233 on tumor progression, MCF-7 cells transfected with miR-223 mimics were subcutaneously injected into nude mice. The results suggested that the tumor volume was significantly lower in the miR-223 mimics group compared with the MCF-7 control group following 20 and 25 days (
Activation of the NLRP3 inflammasome has a critical role in disease development (
According to the present results, NLRP3 knockdown induced cell apoptosis in MCF-7 cells and decreased cell migration. In order to investigate whether the inhibitory effect of shRNA-NLRP3 on the migratory ability was not due to increased apoptosis, the expression level of VEGF, a biomarker of cell migration, was tested. A significant downregulation of VEGF was detected following NLRP3 knockdown, suggesting an inhibitory effect of shRNA-NLRP3 on cell migration. In order to further investigate this phenomenon, the effects of NLRP3 knockdown on epithelial-mesenchymal transition (testing cellular morphology, E-cadherin and N-cadherin) of breast cancer cells require investigation in the future. A previous study demonstrated that miR-233 regulated cell growth and angiogenic properties in cancer cells (
Huang
Collectively, the present study demonstrated that miR-233 may suppress breast cancer cell growth via a mechanism associated with the inactivation of the NLRP3 inflammasome
The authors would like to thank Dr Yuwei Zang, Dr Feng Wang and the members of The Linyi Central Hospital (Linyi, China) and Beijing Tiantan Hospital, for providing technical support to the present study.
The present study was funded by The Youth Foundation of Beijing Tiantan Hospital, Capital Medical University, Beijing, China (grant no. 2015-YQN-09).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
LZ analyzed and interpreted the principal data regarding the cell transfection and
The animal experiments in the present study were approved by The Animal Care and Research Committee of Beijing Tiantan Hospital. All experiments were performed in compliance with relevant laws and guidelines. All experiments were conducted following the institutional guidelines of Beijing Tiantan Hospital.
Not applicable.
The authors declare that they have no competing interests.
sh-NLRP3 suppresses the expression of NLRP3 in MCF-7 cells. (A) NLRP3 expression was detected in three breast cancer cell lines (MDA-MB231, MCF-7 and SKBR3) and in HMECs by RT-qPCR. *P<0.05, **P<0.01 vs. HMEC. (B) sh-NLRP3 was transfected into MCF-7 cells. NLRP3 expression was detected 48 h following transfection by RT-qPCR. An empty plasmid was used as the negative control. (C) NLRP3 expression was detected by western blot analysis using anti-NLRP3 48 h following transfection. *P<0.05 vs. MCF-7. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; sh, short hairpin; NLRP3, NACHT, LRR and PYD domains-containing protein 3; Ctrl, control.
sh-NLRP3 inhibits the growth and migration of human breast cancer cells MCF-7
miR-223 and NLRP3 are inversely associated in human breast cancer cells. (A) Expression of miR-223 was measured by RT-qPCR. ***P<0.001 vs. MCF-7. (B) Effect of miR-223 mimics alone and in combination with pcDNA-NLRP3 on NLRP3 expression was measured by RT-qPCR. (C) Effect of miR-223 inhibitor alone and in combination with sh-NLRP3 on NLRP3 expression was detected by RT-qPCR. *P<0.05. (D) Association between miR-223 and NLRP3 was predicted using the online software Targetscan (
miR-233 suppresses the growth and migration of human breast cancer cells by inactivating the NLRP3 pathway. (A) Cell migration was measured by Transwell assays (magnification, ×400). (B) Ki67 and VEGF protein expression levels were detected by western blotting. (C) Cell proliferation of breast cancer cells following transfection with miR-223 mimics and pc-NLRP3 was measured by Cell Counting kit-8. (D) Protein expression levels of ASC, IL-1β and IL-18 were detected by western blotting. *P<0.05. miR, microRNA; NLRP3, NACHT, LRR and PYD domains-containing protein 3; IL-, interleukin; ASC, PYD and CARD domain-containing protein; VEGF, vascular endothelial growth factor; Ki67, proliferation marker protein Ki67; scram, scramble.
NLRP3 inflammasome inactivation driven by miR-233 reduces the development of tumors
Schematic model of miR-223 regulating cancer growth and immunosuppression by targeting NLRP3 in breast cancer. NLRP3, NACHT, LRR and PYD domains-containing protein 3; miR, microRNA; ASC, PYD and CARD domain containing protein; IL-, interleukin.