PC-3 and DU145, human prostate cancer cell lines, were obtained from the Chinese Academy of Sciences (Shanghai, China). PC-3 and DU145 prostate cancer cells were cultured in RPMI-1640 culture medium (BD Biosciences, San Jose, CA, USA) with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 µg/ml streptomycin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and 100 U/ml penicillin (Sigma-Aldrich; Merck KGaA). The cell lines were maintained in humidified incubators with 5% CO₂ at 37°C. PC-3 and DU145 cells were transfected with an ERβ expression plasmid and empty vector was used as negative control using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Construction of receptor expression vectors was made as previously described (15). Briefly, to construct the human ERβ expression plasmid, ERβ/pcDNA3.1+Zero pcDNA3.1+Zero/ERβ, A 2367 bp fragment including the human ERβ sequence was excised from the ERβ/pcDNA3 plasmid (originally isolated from the ERβ/Pcmv5 plasmid) and inserted into the HindIII/Xbal sites in the vector pCDNA3.1+Zero (Invitrogen; Thermo Fisher Scientific, Inc.). Then, 10 ng/ml of lipopolysaccharide (LPS; Sigma-Aldrich; Merck KGaA) or dimethyl sulfoxide (DMSO; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and PHTPP (a selective ERβ receptor inhibitor, Tocris Bioscience, Bristol, UK) was added to cell cultures and incubated for 24 h with 5% CO₂ at 37°C. The time between transfection and treatment with LPS/DMSO was 12 h.

The sequences of the siRNAs targeting ERβ and scramble RNA were as follows: siRNA-ERβ#1, 5′-GCCCUGCUGUGAUGAAUUAdTdT-3′; siRNA-ERβ#2, 5′-CCACCUUCCUUUCUAUUAUdTdT-3′; siRNA-ERβ#3, 5′-CGGGCUUCAUAAGCUAGAUdTdT-3′; and scramble, 5′-GAACUGAUGACAGGGAGGCTT-3′. Cells (5×10⁴/well) were seeded in 96-well plates. Since the expression level of ERβ was most pronounced with siRNA-ERβ#1, this cell line was selected for the following experiments. DU145 cells were transfected with siRNA (150 pmol/ml) using Lipofectamine 2000^® at 37°C overnight. Prior to transfection, the culture medium was replaced with Opti-MEM^® Reduced Serum Medium (Gibco; Thermo Fisher Scientific, Inc.). The resulting cell populations were selected for further experiments. The levels of ERβ mRNA and protein expression were analyzed via reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting, respectively.

Total RNA was extracted from cells using TRIzol^® (Invitrogen; Thermo Fisher Scientific, Inc.). RNA purity and concentration were determined using a NanoDrop™ 2000 spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). Total RNA was reverse transcribed into cDNA using a PrimeScript Master Mix kit (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocols. The cDNA was amplified with SYBR Green Master Mix (Takara Bio, Inc.), which was performed using a LightCycler^® 96 system (Roche Applied Science, Penzberg, Germany). The primers (5′→3′) used in qPCR were: GAPDH, forward CGACCACTTTGTCAAGCTCA, reverse AGGGGAGATTCAGTGTGGTG; ERβ, forward CAAGCTCATCTTTGCTCCAGA, reverse GCCTTGACACAGAGATATTCTTTG. The thermocycling program was: 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec. At the end of each PCR run, a melting curve analysis from 65 to 95°C was applied to all reactions to ensure the specificity of the amplified product. GAPDH was used as a reference gene, and the qPCR data was analyzed using LightCycler 96 Application Software version 1.1 (Roche Applied Science). The 2^−ΔΔCq method (16) was employed to determine the relative expression of the target gene.

Cells cultured in RPMI-1640 medium were seeded into 96-well plates at a density of 5×10³ cells/well and incubated at 37°C for 24 h. PC-3 and DU145 parental cells (negative vector transfected cells used as the control), and ERβ plasmid-transfected cells were treated with LPS for 24, 48, 72 and 96 h. MTT assay solution (20 µl) was applied to the medium, which was subsequently incubated for 4 h at 37°C. Then, 150 µl DMSO was added to cells for 10 min to solubilize the formazan crystals. Vehicle (0.1% DMSO) was used as the control. The optical density values in each well were measured at 595 nm with an absorption spectrophotometer (Olympus Corporation, Tokyo, Japan). All treatments were performed in triplicate.

Cells (5×10⁴ cells/well) were cultured in serum-free RPMI-1640 medium (500 µl) and plated in the upper chambers of Transwell plates. RPMI-1640 with 15% FBS (600 ml; Beijing Transgen Biotech Co., Ltd., Beijing, China) was plated in the lower chambers. Plates were incubated in humidified conditions with 5% CO₂ for 24 h at 37°C. Then, the inserts were washed with PBS three times, and cells on the upper surface were removed with a cotton swab. The cells remaining on the bottom surface of the inserts were treated with methanol (500 µl, 50 µg/ml) at 4°C for 10 min prior to staining with hematoxylin at room temperature for 10 min. A total of five predetermined fields (magnification, ×200) of each well were selected for cell counting. Images were captured by a photomicroscope (Axiovert 200 M; Carl Zeiss AG, Oberkochen, Germany).

Following rinsing in cold PBS, total protein was extracted from the cells using lysis buffer (0.1% SDS, 50 mmol Tris-base, 1% Triton X-100, 150 mmol sodium chloride, 1 mmol sodium orthovanadate, 0.5% sodium deoxycholate, 1% protease inhibitor cocktail and 10 mmol sodium fluoride) and quantified using the Bradford protein assay. Proteins (20 µg) were separated via 10% SDS-PAGE at 100 V and electrotransferred onto 0.45 µm polyvinylidene difluoride membranes. The membranes were blocked with 5% non-fat milk in TBS-Tween 20 (10%) at room temperature for 2 h, and then incubated with primary antibodies against ERβ (1:500; cat. no. ab3576), p65 (1:100; cat. no. ab16502), NF-κB inhibitor α (IκBα, 1:200; cat. no. ab32518), phosphorylated (p)-IκBα (1:200; cat. no. ab133462), proliferating cell nuclear antigen (PCNA; 1:50; cat. no. ab92552), E-cadherin (1:100; cat. no. ab40772), B-cell lymphoma 2-associated X protein (Bax; 1:200; cat. no. 32503), caspase-3 (1:200; cat. no. ab32351), matrix metalloproteinase-2 (MMP-2; 1:200; cat. no. ab37150) and β-actin (1:50; cat. no. ab8226; Abcam, Cambridge, UK) overnight at 4°C. Anti-rabbit HRP-conjugated secondary antibody (Thermo Fisher Scientific, Inc.) was then added at room temperature for 1 h, and membranes were incubated for 20 min. Protein bands were visualized using an enhanced chemiluminescence kit (Pierce; Thermo Fisher Scientific, Inc.). Protein expression was quantified using Total Lab Nonlinear Dynamic Image (version 2009) analysis software (MathWorks, Natick, MA, USA).

High binding microtiter plates were coated overnight at 4°C with 100 µl per well of III-BSA coating antigen (0.05 µg/ml in coating buffer). Cells were then rinsed with PBS and blocked with 3% bovine serum albumin (BSA; Beijing Transgen Biotech Co., Ltd.) in PBS for 1 h at room temperature. Anti-tumor necrosis factor-α (TNF-α; cat. no. ab91235), anti-interleukin (IL)-1β (cat. no. ab242234), anti-monocyte chemoattractant protein-1 (MCP-1; cat. no. ab9669) and anti-IL-6 (cat. no. ab178013) monoclonal antibodies were purchased from Abcam, and were diluted in PBS + 3% BSA, added to cells and incubated at room temperature for 2 h. Following washing with PBS, cells were incubated with goat anti-mouse secondary antibodies (1:100; cat. no. BMS2007INST; Thermo Fisher Scientific, Inc.), and incubated for 60 min at room temperature. Cells expressing TNF-α, IL-1β, MCP-1 and IL-6 were detected using an ELISA Kit according to the manufacturer's protocols; protein concentrations were determined using a Spectramax M5 plate reader (Molecular Devices, LLC, Sunnyvale, CA, USA).

Apoptotic cell death was determined using the Annexin V (conjugated to Alexa Fluor 594; excitation/emission: 590/617 nm) Apoptosis Detection Kit (BioVision, Inc., Milpitas, CA, USA) and PI. Following transfection, cells were incubated for 48 h, and then collected and stained with Annexin V/PI according to the manufacturer's protocols. The percentage of early apoptotic, late apoptotic and necrotic cells were determined using a flow cytometer (BD Bioscience) and analyzed with guavaSoft 3.1.1 software (EMD Millipore, Billerica, MA, USA). The occurrence of apoptosis in each group was investigated in ≥3 independent experiments.

SPSS 19.0 (IBM Corp., Armonk, NY, USA) was used for all statistical analyses. Data are presented as the mean ± standard deviation. Comparisons across three or more groups were performed using one-way analyses of variance followed by Tukey's test, while a Student's t-test was used to determine significant differences between two groups. P<0.05 was considered to indicate a statistically significant difference. All tests were investigated in ≥3 independent experiments.

Following incubation with LPS for 24 h, the expression levels of proinflammatory cytokines in the supernatants of the prostate cancer cell lines PC-3 and DU145 were determined using ELISA. Stimulation with LPS led to significantly elevated expression levels of TNF-α, MCP-1, IL-1β and IL-6 in PC-3 and DU145 cells compared with controls treated with DMSO (P<0.05; Fig. 1A). These results indicated that LPS successfully induced inflammation in prostate cancer cells.

To investigate whether p65 is regulated by ERβ signaling, the expression levels of proteins involved in the NF-κB pathway were determined. As presented in Fig. 1B, increased p65 and p-IκBα expression, and decreased ERβ expression were observed in LPS-stimulated PC-3 and DU145 cells compared with the controls; however, no significant differences were reported for total IκBα expression.

To investigate the role of the NF-κB pathway in the regulation of ERβ-induced inflammation, western blot analysis was performed to determine the expression of NF-κB pathway-associated proteins in PC-3 and DU145 cells transfected with an ERβ expression vector or treated with the ERβ antagonist PHTPP. It was revealed that ERβ overexpression suppressed the expression of p65 and p-IκBα, but not total IκBα expression in LPS-stimulated PC-3 and DU145 cells compared with control cells. This expression profile was reversed following treatment with PHTPP (Fig. 2A).

Providing ERβ is a suppressor of prostate inflammation, ERβ activation may suppress the expression of certain proinflammatory genes. To investigate the involvement of ERβ signaling in LPS-induced inflammation, the expression of the proinflammatory cytokines TNF-α, IL-1β, MCP-1 and IL-6, was determined in cells overexpressing ERβ and transfected cells treated with PHTPP via ELISA. The results demonstrated that the LPS-induced production of TNF-α, MCP-1, IL-1β and IL-6 was significantly reduced in prostate cancer cells following overexpression of ERβ compared with negative control vector cells (P<0.05; Fig. 2B). This expression profile was significantly reversed in PHTPP-treated transfected cells compared with ERβ-overexpressing cells (P<0.05). These data suggested that ERβ signaling regulated LPS-induced prostate cancer cell inflammation.

To determine the effects of ERβ overexpression on prostate cancer cell viability, apoptosis and migration, MTT, Annexin V/PI and Transwell assays were performed using control, ERβ-overexpressing, and ERβ-inhibited cells. As presented in Fig. 3A, ERβ overexpression significantly suppressed the viability of PC-3 and DU145 cells compared with control and PHTPP-treated transfected cells (P<0.01). When cells were treated with PHTPP, their viability was markedly reduced compared with ERβ-overexpressed cells. Furthermore, the number of apoptotic cells among those treated with ERβ transfection was significantly higher compared with control and ERβ-inhibited cells (P<0.01; Fig. 3B). The cell migration assay revealed that upregulation of ERβ significantly decreased migration compared with control and PHTPP-treated transfected PC-3 and DU145 cells (P<0.01; Fig. 4A).

As ERβ signaling appeared to be involved in the regulation of cell viability, apoptosis and migration, and the expression of proteins associated with these properties was determined. PCNA, Bax and caspase-3, and MMP-2 and E-cadherin were selected as markers of proliferation (17), apoptosis (18) and epithelial-mesenchymal transition-associated migration (19), respectively. As presented in Fig. 4B, overexpression of ERβ suppressed the expression of PCNA and MMP-2, but promoted the expression of Bax, caspase-3 and E-cadherin in PC-3 and DU145 cells. These alterations in expression were reversed by treatment with PHTPP.

To further investigate the effects of ERβ on the progression of prostate cancer, ERβ-targeting siRNAs were employed to downregulate ERβ expression in DU145 prostate cancer cells. The silencing effects of three siRNAs compared with a negative control scramble siRNA were reported via RT-qPCR analysis (Fig. 5A); siRNA-ERβ#1 was selected for subsequent experiments, as it exhibited a notable effect on ERβ expression compared with siRNAs-ERβ#2 and 3. Decreased levels of ERβ protein expression in prostate cancer cells following transfection with siRNA-ERβ#1 were demonstrated via western blot analysis (Fig. 5B). ERβ knockdown induced similar effects to treatment with PHTPP; increased expression of p65 and p-IκBα was observed, but not of total IκBα compared with scramble-transfected cells (Fig. 5B). Furthermore significantly increased cell viability (Fig. 5C), decreased number of apoptotic cells (Fig. 5D), upregulated expression of proinflammatory cytokines (Fig. 5E), enhanced cell migration (Fig. 5F) and altered expression of associated proteins (Fig. 5G) were reported in DU145 prostate cancer cells following transfection with siRNA-ERβ#1 compared with scramble-transfected cells. Collectively, these findings indicated that upregulation of ERβ reduced the viability and migration, and increased the apoptosis of human prostate cancer cells, which may suppress the progression of prostate cancer.