From September 2016 to September 2017, 41 NPC tumor and adjacent healthy tissues were collected from 19 males and 22 females (aged 49–80 years, with a mean of 58.53±6.36 years) at the Department of Pathology, Tongde Hospital of Zhejiang Province (Hangzhou, China). The samples were stored at −80°C prior to subsequent experimentation. Patients included in the present study exhibited NPC that was histologically confirmed by biopsy, and no history of previous head and neck cancer. Patients with incomplete clinical data were excluded. In addition, NPC patients were staged according to the criteria of the 8th edition of The Union for International Cancer Control/American Joint Committee on Cancer staging system (27). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to determine the expression levels of SERPINC1 mRNA in each tissue sample. The patients were divided into low- and high-expression groups according to the median value of SERPINC1 mRNA expression. A total of 6 cases were randomly selected from the 41 patients the analysis of SERPINC1 protein via western blotting. All patients provided signed informed consent, and the experiment was approved by the Ethics Committee of Tongde Hospital of Zhejiang Province.

The poorly differentiated squamous cell carcinoma NPC cell line HNE3 was purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin at 37°C in an incubator with 5% CO2. All culture reagents were purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

In total, 2×105 cells/well were seeded in 24-well culture plates, and 0.5 ml medium without antibiotic was added in each well. Cells at 90% confluence were transfected. siRNA targeted against SERPINC1 (SERPINC1-siRNA) was purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). siRNA (50 nM) transfection was performed using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) to generate the SERPINC1-siRNA group. Negative-siRNA (Thermo Fisher Scientific, Inc.) was inserted into an empty vector (pcDNA3.1; Thermo Fisher Scientific, Inc.), which served as the empty vector control group; a non-transfected control group was also established. The sequences of the siRNAs used in the present study were as follows: SERPINC1-siRNA forward, AUCACAUUGGAAUACAUGGCC and reverse, CCAUGUAUUCCAAUGUGAUAG; negative-siRNA forward, CAUGUGGUCUGUCGCAUAAUA and reverse, CGGUACACCAGACAGCGUAUU. Following transfection for 48 h, cells were harvested, and the efficiency of transfection was determined via RT-qPCR and western blot analysis.

A Cell Counting Kit-8 (CCK-8) assay was used to determine cell viability. Transfected cells at a density of 3×103 cells/well were inoculated in a 96-well plate and incubated at 37°C with 5% CO2 for 12, 24 and 48 h following transfection. CCK-8 reagent (10 ml; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was then added to each well and cultured together at 37°C with 5% CO2 for 4 h. The absorbance of each well at 450 nm was measured using a microplate reader (ELx800; BioTek Instruments Inc., Winooski, VT, USA), and cell viability was calculated according to the standard curve.

Flow cytometry was used to evaluate cell apoptosis. Cells (1×106) were washed with PBS at 4°C and resuspended to a concentration of 4×105 cells/ml. Phycoerythrin-Annexin V Apoptosis Detection kit (5 µl; BD Pharmingen; BD Biosciences, San Jose, CA, USA) was added to cell culture (200 µl), and then 10 µl 7-aminoactinomycin D (20 µg/ml; BD Biosciences) was added. The samples were incubated at room temperature in the dark for 10 min. The BD FACSCanto flow cytometer (BD Biosciences) was used to analyze apoptosis at 488 nm, analysis of data was performed using the FSC Express software (version 3; De Novo Software, Glendale, CA, USA). Living cells are presented in the lower left quadrant, necrotic cells in the upper left quadrant, advanced apoptotic cells in the upper right quadrant, and early apoptotic cells in the lower right quadrant. The proliferation of HNE3 cells was also analyzed via flow cytometry. Click-iT^® Plus EdU Pacific Blue flow cytometry kit (Thermo Fisher Scientific, Inc.) was applied to detected the cell proliferation.

RT-qPCR was performed to investigate the expression levels of SERPINC1, B-cell lymphoma-2 (Bcl-2)-associated X protein (Bax), Bcl-2, survivin, cyclin D1 and p53 mRNA; GADPH was used as a reference gene. RNA was extracted from NPC tissues and cells using TRIzol^® (Thermo Fisher Scientific, Inc.) at 0°C for 5 min, isolated with CHCl3 (Aladdin Shanghai Biochemical Technology Co., Ltd., Shanghai, China) and then dissolved in diethyl pyrocarbonate-treated water (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). RNA concentration was determined using a NanoDrop One Microvolume UV–Vis Spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). RT was performed on RNA samples using the PrimeScript first Strand cDNA synthesis kit (Takara Bio, Inc., Otsu, Japan) to synthesize cDNA. The RT reaction was performed at 37°C for 15 min, followed by reverse transcriptase inactivation at 85°C for 15 sec. RT-qPCR reactions were performed using an ABI 7500 real-time PCR system (Thermo Fisher Scientific, Inc.), using the SYBR Prellix Ex Taq™ Real-Time PCR Kit (Takara Bio, Inc.). qPCR was performed by activating the DNA polymerase at 95°C for 5 min, followed by 40 cycles of two-step PCR (at 95°C for 10 sec and at 60°C for 30 sec) and a final extension at 75°C for 10 min prior to holding at 4°C. DNase- and RNase-free water were used as negative control templates. All primers used were purchased from Genewiz, Inc. (Suzhou, China) and are presented in Table I. The 2-ΔΔCq method (28) was applied to analyze relative expression levels of target genes normalized to GADPH. Each experiment was performed in triplicate.

The expression of SERPINC1, apoptosis-, cell cycle-proteins, and phosphatidylinositol 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathway-associated proteins were determined via western blot analysis; phosphorylation levels were also determined. Tissues and cells were lysed using liquid nitrogen and radioimmunoprecipitation assay buffer (Abmole Bioscience, Inc., Houston, TX, USA), and subsequently subjected to cleavage and lysis using 1% phenylmethane sulfonyl fluoride protease and phosphatase inhibitors (Abmole Bioscience, Inc.), for 30 min at 4°C. The supernatant was collected by centrifugation at 12,000 × g at 4°C for 15 min. Total protein concentration was determined using the bicinchoninic acid method. In total, 10 µg protein was loaded in each lane. Proteins were separated by 10% SDS-PAGE. The separated proteins were transferred onto a polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using a Trans-Blot Transfer Slot (Bio-Rad Laboratories, Inc.) and blocked with 5% skimmed milk for 2 h at room temperature. The membranes were incubated with the following primary antibodies obtained from Abcam (Cambridge, UK): Anti-SERPINC1 (1:800; ab126598); anti-Bax (1:700; ab32503); anti-Bcl-2 (1:900; ab32124); anti-survivin (1:700; ab76424); anti-cyclin D1 (1:800; ab134175); anti-p53 (1:600; ab26); anti-PI3K (1:700; ab125633); anti-phosphorylated (p)-PI3K (1:600; ab138364); anti-Akt (1:800; ab8805); anti-p-Akt (1:800; ab38449); anti-mTOR (1:800; ab2732); anti-p-mTOR (1:600; ab109268) and anti-GADPH (1:800; ab8245). Following the application of primary antibodies, membranes were agitated at room temperature for 2 h, and then incubated at 4°C for 12 h. Subsequently, membranes were incubated at room temperature for 1.5 h with the following secondary antibodies: Fluorescein isothiocyanate-conjugated goat anti-mouse IgG (1:8,000; ab6785; Abcam); horseradish peroxidase (HRP)-conjugated mouse anti-rabbit IgG (1:9,000; ab99697; Abcam); mouse anti-rabbit IgG (1:7,000; BA1034; Invitrogen; Thermo Fisher Scientific, Inc.); NL557-conjugated donkey anti-rabbit IgG (1:5,000; NL004; R&D Systems, Inc., Minneapolis, MN, USA); HRP-conjugated rabbit anti-human IgG (1:10,000, ab6759; Abcam). Protein bands were visualized using an enhanced chemiluminescence reagent (Thermo Fisher Scientific, Inc.). The optical density was quantified using ImageJ software (version 1.46; National Institutes of Health, Bethesda, MD, USA).

Experimental data were presented as the mean ± standard deviation. Data were analyzed using SPSS version 20.0 (IBM Corporation, Armonk, NY, USA). All experiments were performed three times. Differences between two groups were analyzed using paired Student's t-tests. One-way analyses of variance were performed to analyze differences between experimental groups, with Tukey's multiple comparison test used as a post hoc test. Associations between clinicopathological data and SERPINC1 expression were analyzed using χ2 tests. P<0.05 was considered to indicate a statistically significant difference.

RT-qPCR and western blotting were performed to analyze the levels of SERPINC1 expression in tumor and adjacent healthy tissues from patients with NPC. It was revealed that SERPINC1 protein and mRNA expression levels were significantly increased in NPC tissues compared with in adjacent tissues (P<0.05; Fig. 1A-C). As presented in Table II, patients were separated into low- and high-expression groups according to the median value of SERPINC1 mRNA expression, and associations with clinicopathological features were investigated. It was demonstrated that increased SERPINC1 expression was significantly associated with the metastasis of NPC. The results suggested that the SERPINC1 gene was overexpressed in NPC tissues.

The human poorly-differentiated squamous cell carcinoma NPC cell line HNE3 was used to study the role of SERPINC1 in NPC; si-SERPINC1 was transfected into HNE3 cells. The efficiency of SERPINC1-siRNA transfection was determined via RT-qPCR and western blot analysis. It was demonstrated that the expression levels of SERPINC1 mRNA and protein were significantly decreased in HNE3 cells following SERPINC1 knockdown compared with the negative siRNA-transfected (empty vector) control group (P<0.01; Fig. 2A-C). The proliferation of HNE3 cells was determined via a CCK-8 assay; cell proliferation was significantly reduced at 12, 24 and 48 h following transfection with SERPINC1-siRNA compared with the empty vector control (P<0.05, P<0.05 and P<0.01; Fig. 2D). The results indicated that transfection of the SERPINC1-siRNA were successfully conducted, and that downregulation of SERPINC1 expression induced a decrease in the proliferation of NPC cells.

Flow cytometry was performed to investigate the apoptosis and proliferation of HNE3 cells following SERPINC1-siRNA transfection. No significant differences in apoptosis or proliferation were reported between the empty vector and non-transfected control groups. Conversely, the apoptotic rate of the SERPINC1-siRNA group was significantly increased compared with the empty vector group (P<0.01; Fig. 3A and B), whereas proliferation was reduced following SERPINC1 knockdown compared with the empty vector group (P<0.01; Fig. 3C and D). The results indicated that SERPINC1 gene silencing inhibited the proliferation and promoted the apoptosis of NPC cells.

To further investigate the effects of SERPINC1 knockdown on the proliferation and apoptosis of HNE3 cells, RT-qPCR and western blot analyses were conducted to determine the expression of apoptosis-associated (Bax, Bcl-2 and survivin) and cell cycle-associated (cyclin D1 and p53) genes and proteins, respectively. It was revealed that the expression levels of Bax mRNA were significantly upregulated in SERPINC1-siRNA-transfected cells compared with the empty vector group, whereas those of Bcl-2 and survivin mRNA were downregulated (P<0.01; Fig. 4A-C). Additionally, the expression levels of cyclin D1 mRNA were significantly decreased and those of p53 increased following silencing of the SERPINC1 gene compared with the empty vector group (P<0.01; Fig. 4D-G). Similar alterations in the expression levels of the genes were also reported at the protein level (P<0.01; Fig. 4F and G), indicating that the suppression of SERPINC1 expression promoted the expression of proapoptotic factors, inhibited the expression of antiapoptotic factors and suppressed proliferation via regulation of cell cycle-associated genes in NPC cells.

The mechanisms underlying the effects of SERPINC1 on the proliferation and apoptosis of NPC cells were investigated by evaluating the expression and phosphorylation levels of PI3K/Akt/mTOR-associated proteins. It was revealed that the phosphorylation levels of PI3K, Akt and mTOR were significantly decreased in HNE3 cells following transfection with SERPINC1-siRNA compared with the empty vector control group (P<0.01; Fig. 5A-D), suggesting that SERPINC1 knockdown inhibited the activity of the PI3K/Akt/mTOR pathway.