Male pathogen-free C57BL/6 mice were obtained from the Laboratory Animal Research Center of Shanghai (SLAC, Shanghai, China). Each male pathogen-free C57BL/6 mice (8–12 weeks of age and weighing approximately 25 g) were raised in cages in an air-conditioned room (20±1°C) with controlled 12 h light/dark and maintained on standard laboratory food (Global Diet; Shanghai, China) and water ad libitum at the Laboratory Animal Center of Tongji (Shanghai, China). The total number of mice used in experiments was 40 (8 mice per group).

All animal studies were conducted in accordance with the National Institute of Health Guidelines on the use of laboratory animals and approved by the Ethics Committee of the University of Tongji (23).

Peritoneal macrophages were isolated from C57BL/6 mice as previously described (24). Peritoneal macrophages were treated with PNU-282987 (20–100 µM, P6499; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), and agents were added 60 min before the challenge with lipopolysaccharides (LPS) (10 ng/ml, Escherichia coli 055:B5; List Biological Laboratories, Inc., Campbell, CA, USA).

Male C57BL/6 mice (6–8 weeks old) were randomly divided (n=8) into the sham group treated with vehicle (group control), the sham group treated with PNU-282987 (group PNU), the CLP group treated with vehicle (group CLP), and the group treated with PNU-282987 (1 mg/kg) administered 1 h before or 2 h after CLP (group CLP-Pre or CLP-Post). The surgical procedure to generate CLP-induced sepsis was performed as previously described (24). In brief, mice were anesthetized with sevoflurane, and a middle abdominal incision was made. The cecum was mobilized, ligated, and punctured with a 22-gauge needle. The bowel was repositioned and the abdomen was closed. The animals were resuscitated with sterile saline subcutaneously immediately after CLP surgery. The sham-operated control mice underwent the same procedure, without ligation or puncture of the cecum. All mice were sacrificed by cervical dislocation at 12 or 24 h after CLP. Blood samples were collected in tubes containing heparin. BALF was centrifuged immediately (at 4°C, 800 × g for 10 min) for harvesting of the cells and the supernatant. The supernatant was used to measure TNF-α and IL-6, and the deposits were collected for neutrophil and macrophage counting by Wright-Giemsa staining. Histopathological changes were examined in right lung tissues. Left lung tissues were collected for real-time reverse transcriptase polymerase chain reaction (RT-PCR).

For histological analyses, lung tissues were fixed in 4% paraformaldehyde phosphate-buffered saline (PBS) for 48 h at room temperature, embedded in paraffin, and sliced into 5-µm-thick sections using a machine. After deparaffinization, slides were stained with hematoxylin and eosin (H&E). Morphological alterations in the lungs were examined by a light microscopy (Leica DM6000 B, Leica, Wetzlar, Germany) and scored based on the extent of pathology on a scale of 0 to 4 by measuring interstitial edema, alveolar edema, hemorrhage and neutrophil infiltration (0, none, 4, severe). Composite lung injury scores represent the sum of the mean injury subtype scores for each condition on a scale of 0 to 16. All histological studies were performed in a blinded fashion.

The effect of PNU-282987 on peritoneal viability was measured using the standard MTT assay as previously described by Wei et al (25). Briefly, cells were seeded in 96-well culture plates at a density of 2×104 cells/well and allowed to attach overnight. Cells were washed twice with PBS and subsequently treated with various concentrations of PNU-282987 from 0.1 to 1 mM for 24 h. Then, 20 µl of MTT (Sigma-Aldrich; Merck KGaA) was added to each well and incubated for 4 h at 37°C. After removing the MTT solution, 200 µl of dimethyl sulfoxide (DMSO; Sigma-Aldrich; Merck KGaA) was added to each well. The absorbance was determined using a Synergy 2 Multiple ELISA (BioTek Instruments, Inc., Winooski, VT, USA) at a wavelength of 570 nm.

Levels of TNF-α and IL-6 were measured using commercially available ELISA assay kits (Bio-Ray, Laguna Hills, CA, USA) according to the manufacturer's instructions.

To detect the levels of p-P38MAPK (dilution 1:1,000; cat. no. 4511), p-JNK (dilution 1:800; cat. no. 4668) and p-ERK (dilution 1:1,200; cat. no. 4370; all from Cell Signaling Technology, Danvers, MA, USA) in peritoneal macrophages, immunoblotting was performed as previously described (21). Whole-cell lysates were prepared using RIPA (Beyotime Institute of Biotechnology, Haimen, China) containing protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany) and 10 µg/ml phenylmethylsulfonyl fluoride (PMSF). The protein concentration was determined by the Bradford method (Bio-Rad Laboratories, Hercules, CA, USA). Equal amounts (20 µg) of the lysate were boiled for 8 min in equal volumes of 6X SDS buffer. The protein samples were subjected to electrophoresis on a 10% sodium dodecyl sulfate (SDS)-polyacrylamide and transferred to a polyvinylidene difluoride (PVDF) membrane using a semi-dry transfer apparatus (Bio-Rad Laboratories). Non-specific binding sites were blocked with 5% skim milk in PBST (phosphate buffer solution with Tween-20) at room temperature for 1 h. After washing three times with PBST buffer, the membrane was incubated with the primary antibody overnight at 4°C. For total proteins, β-actin was used as a loading control. The blots were washed three times with PBST and incubated with goat anti-rabbit IRDye 800CW or goat anti-mouse IRDye 800CW-conjugated secondary antibody (dilution 1:10,000; cat. no. P/N.925-32211 or 926–32210; LI-COR Biosciences, Lincoln, NE, USA) for 1 h at room temperature. The blots were washed three times with PBST, and the proteins were visualized using LI-COR Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA).

Total RNA was extracted from lung tissue or peritoneal macrophages by adding TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. The TNF-α, IL-6 and β-actin mRNA levels were quantified in triplicate by SYBR Green two-step, real-time RT-PCR. Total RNA (1 µg) from each sample was used for reverse transcription with oligo-dT primers (Takara Bio, Inc., Otsu, Japan) and SuperScript II Reverse Transcriptase (Takara Bio, Inc.) to generate the first-strand cDNA. The PCR mixture was prepared using SYBR-Green PCR Master Mix (Takara) using the following primers: TNF-α forward, AAGCCTGTAGCCCACGTCGTA and reverse, AGGTACAACCCATCGGCTGG; IL-6 forward, CCACTTCACAAGTCGGAGGCTTA and reverse, GCAAGTGCATCATCGTTGTTCATAC; β-actin forward, GGCTGTATTCCCCTCCATCG and reverse, CCAGTTGGTAACAATGCCATGT.

The mean fold-changes in the expression of TNF-α and IL-6 mRNA in the experimental group compared with the control group were calculated using the 2^−ΔΔCq method (26).

All experiments were repeated at least three times with nearly identical results, and the data are presented as means ± SEM. One-way analysis of variance (ANOVA) followed by Newman-Keuls post hoc test was performed to assess significant differences. Differences were considered statistically significant at P<0.05.

Among the vital organs in the body, the lung is particularly susceptible to acute injury in CLP-induced polymicrobial sepsis. Excessive inflammatory cell infiltration plays a key role in pulmonary failure during sepsis. To determine whether PNU-282987 could protect mice against sepsis-induced ALI, we examined the quantity and type of cells in BALF and examined morphological manifestations in the lung by H&E staining at 24 h after CLP. After the induction of sepsis by CLP, marked elevations in total cells, neutrophils, and macrophages were observed compared to the cell counts in the control group. The mice that received pretreatment with PNU-282987 exhibited decreased numbers of neutrophils and macrophages in BALF as well as the total cells when compared to those in the CLP mice. The mice that received post-treatment with PNU-282987 showed a decreased number of neutrophils and macrophages but statistical difference was not achieved (Fig. 1A). Histopathological analysis of paraffin-embedded lung sections by H&E staining showed that lung tissues from CLP mice exhibited severe edema and infiltration of inflammatory cells. In contrast, inflammatory cell infiltration and edema were obviously attenuated in the lungs after treatment with PNU-282987 (1 mg/kg) both pre- and post-surgery in mice (Fig. 1B). We then evaluated the lung injury using histological sections by applying a semi-quantitative scale (described in detail in Materials and methods). As shown in Fig. 1C, the total injury score in lungs after CLP was significantly increased compared to that of the control group, while the score was significantly reduced when septic mice received PNU-282987.

The inflammatory response is induced in sepsis. Accordingly, we examined the levels of TNF-α and IL-6 in the serum and BALF of septic mice by ELISA at 12 and 24 h after CLP. The level of IL-6 was significantly increased in the CLP group compared to that in the control group. Neither PNU-282987 pre- nor post-CLP treatment significantly reduced IL-6 release in the serum (Fig. 2A). IL-6 levels in BALF were significantly decreased in the CLP-pre and CLP-post groups compared to those in the CLP group at 12 and 24 h (Fig. 2B). We did not observe significant differences in the TNF-α level among CLP and CLP with PNU-282987 administration groups in serum and BALF (Fig. 2C and D), except for the TNF-α level in the CLP group compared with the control which was significantly increased at 12 h. We also examined changes in the mRNA levels of TNF-α and IL-6 in the lung tissue by RT-PCR. In the lungs of septic mice, mRNA expression levels of TNF-α and IL-6 were significantly increased. The increases in the mRNA expression levels of IL-6 and TNF-α were significantly suppressed by PNU-282987 pretreatment. Post-treatment with PNU-282987 significantly inhibited IL-6 mRNA expression, but resulted in only slight decreases in TNF-α expression in the lung tissue (Fig. 2D and E). Our results suggest that PNU-282987 treatment inhibits the local inflammatory response in sepsis.

Cell viability, essentially the mitochondrial activity of living cells, was measured by a quantitative colorimetric assay with MTT. In vitro, peritoneal macrophages were treated with PNU-282987 for 24 h and no significant differences in viability were found at concentrations ranging from 0.1 to 100 µM when compared with viability in the control cultures (Fig. 3).

To detect the effect of PNU-282987 on LPS-induced macrophage activation, the macrophage inflammatory cytokine production (TNF-α and IL-6) was examined after exposure to LPS (10 ng/ml) and PNU-282987 at various concentrations or time-points in vitro. The levels of TNF-α and IL-6 in the culture supernatant were significantly decreased by pretreatment with PNU-282987 in a dose-dependent manner at 8 h (Fig. 4A and B). Pretreatment with PNU-282987 at 100 µM inhibited LPS-induced TNF-α and IL-6 release in a time-dependent manner (Fig. 4C and D). PNU-282987 pretreatment also significantly decreased TNF-α and IL-6 mRNA expression in macrophages at early times (4 and 8 h) (Fig. 4E and F). PNU-282987 had no inhibitory effect on the production of cytokines in resting cells.

The MAPK cascade is the key downstream pathway for LPS-stimulated signaling events (7,27). To further explore the intracellular mechanisms underlying the anti-inflammatory effects of PNU-282987, we investigated whether PNU-282987 could inhibit the LPS-induced activation of MAPK pathways. The MAPK family involves three major subgroups, including p38, ERK1/2 and JNK. The activation of p38, ERK1/2 and JNK were assessed by their phosphorylation levels. LPS strongly activated all three families of MAPKs in peritoneal macrophages in a time-dependent manner. PNU-282987 pretreatment significantly prevented LPS-induced increases in the levels of phosphorylated p38, ERK1/2 and JNK in a time- and dose-dependent manner (Fig. 5).