CRC and adjacent normal tissues were obtained from 45 patients with CRC undergoing resection. There were 22 males and 23 females, aged 30–55 years, with a mean of 38.5±1.4 years. Inclusion criteria were: i) Patients who conformed to the diagnostic criteria of CRC and ii) Patients who had undergone surgical resection. Excluded were patients with other malignant tumors. The specimens were collected between May 2015 and October 2017 in the Department of Gastroenterological Surgery of The Second People's Hospital of Lianyungang (Lianyungang, China). All tissues were confirmed by pathological examination. Informed consent was obtained from all patients and ethical approval was obtained from the Institutional Review Board of The Second People's Hospital of Lianyungang. Samples were fixed before paraffin embedding, usually for 4 to 24 h at room temperature. Fresh tissue was fixed in 4% paraformaldehyde for >24 h. Once the tissue was removed from the fixative, the tissue of the target site was smoothed in a fume hood with a scalpel, and the trimmed tissue and corresponding label placed in the dehydration box. Thereafter, the dehydration box was placed in a hanging basket and dehydrated with a graded series of alcohol. The tissue was embedded in an embedding machine; the melted wax first placed in the embedding frame, and the tissue placed in the embedding frame according and a corresponding label was attached. It was then placed in a −20°C freezer. When the paraffin was solidified, the wax block was removed from the embedding frame and the wax block trimmed. Finally, the trimmed wax block was placed on a microtome. The thickness of the sections were ~2–3 mm. Normal colorectal cells (CCD-18Co) and CRC cell lines (HT-29, SW116, HCT116, SW480 and SW620) together with 293 cells were purchased from the American Type Culture Collection (Manassas, VA, USA). SW116 and SW620 cells were grown in Leibovitz's L-15 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.). HCT-116 cells were cultured in Ham's F12K medium (Thermo Fisher Scientific, Inc.) containing 10% FBS. SW480 and HT-29 cells were incubated in RPMI-1640 medium (Thermo Fisher Scientific, Inc.) containing 10% FBS. Cells were cultured at 37°C in a humidified atmosphere with 5% CO₂.

SW620 cells were transfected with 50 nM hsa-miR-183-5p mimics or inhibitor (Wuhan GeneCreate Biological Engineering Co., Ltd., Wuhan, China), or with adenovirus RCN2 or RCN2 small interfering (si)RNA at the same time (50 nM; Shanghai GeneChem Co., Ltd., Shanghai, China) using Lipofectamine^® 2000 transfection reagent (Thermo Fisher Scientific, Inc.) for 48 h, according to the manufacturer's protocol. The sequences of hsa-miR-183-5p used in this study was: 5′UAUGGCACUGGUAGAAUUCACU3′; The sequences of small-interfering RNA for RCN2 is: Forward 5′-GCGTGAGATGGTACGAACT-3′, reverse 5′-AGGCTTACACCCTCATACAT-3′. All experimental control samples were treated with an equal concentration of a non-targeting control mimic sequence (negative controls).

The proliferation of SW620 cells was measured using MTT assay kits (Dojindo Molecular Technologies, Inc., Kumamoto, Japan). Cells were seeded at 2×10³ cells/well in 96-well plates and were cultured for 24–96 h. Next, MTT assay was performed at 0, 24, 48, 72 and 96 h, after which the optical density values were recorded. The formazan was dissolved by DMSO in the MTT experiment and its absorbance was measured at the wavelength of 490 nm.

The SW620 cells were harvested following transfection with miRNA mimic or inhibitor, and adenovirus RCN2 or RCN2 siRNA. The cell cycle assay was performed using a propidium iodide (PI) cell cycle detection kit (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China), according to the manufacturer's protocol, and detection was performed with a FACScan flow cytometer and FACSCanto II version 4.1 (BD Biosciences, San Jose, CA, USA).

SW620 cells were resuspended in 100 µl serum-free medium and plated in the top chamber of each insert (8-µm pore size; Corning Inc., Corning, NY, USA) with a Matrigel-coated membrane (BD Biosciences) for the Transwell assay. SW620 cells were incubated in serum-free medium for 24 h, and subsequently trypsinized and suspended with culture medium containing 0.1% FBS (Thermo Fisher Scientific, Inc.) albumin at a concentration of 4×10⁴ cells/ml. Subsequently, 500 µl cell suspension was added to each well for 36 h. The lower chambers of the inserts were filled with Dulbecco's modified Eagle's medium (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) with 10% FBS. After 24 h, the invasive cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet at room temperature. The number of invasive cells was counted in 5 randomly selected fields of view and images acquired. After 24 h, the invasive cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet at 37°C for 20 min. The number of invasive cells was counted in 5 randomly selected fields of view and images acquired under a light microscope (magnification, ×400).

Total RNA from CRC and adjacent normal tissues, and CRC cell lines, were extracted using TRIzol^® (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The purity of the RNA was determined by measuring the absorbance at 260–280 nm using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Inc.). RT was performed using a PrimeScript RT kit (cat. no. RR036A; Takara Bio, Inc., Otsu, Japan), and RT-qPCR was performed using a SYBR Premix kit (cat. no. RR420A; Takara Bio, Inc.). Total RNA was reverse transcribed into complementary DNA (cDNA) in a reaction system (25 µl) composed of 5 µl 5X M-MLV RT buffer, 2 µl dNTP mix (2.5 mM), 1 µl RNase inhibitor (30 U/µl), 1 µl M-MLV Reverse Transcriptase and 16 µl double distilled H₂O. The RNA was reverse transcribed into cDNA according to the instructions of the reverse transcription kit: Pre-denatured at 95°C for 5 min, denatured at 95°C for 15 sec, annealed at 60°C for 30 sec, extended at 72°C for 30 sec, 40 cycles, and maintained at 72°C for 10 min. The data were normalized to the levels of GAPDH and were further analyzed using the 2^−ΔΔCq method (17).

The primers used in the study were as follows: miR-183-5p forward 5′TCACTTAAGATGGTCACGGTAU3′, and reverse 5′ATAGACCAACAGGTGTACTGA3′; RCN2 forward 5′CCCGACCTCTTCAGCGGGCA3′ and reverse, 5′CTTGGGGCAGGGGCTCTTGAC-3′; and GAPDH forward 5′TGGATTCGACTTAGACTTGACCT-3′, and reverse 5′GGTGGGTTATGGTCTTCAAAAGG3′.

Proteins from the cells were extracted using radioimmunoprecipitation assay lysis buffer (Sigma-Aldrich; Merck KGaA). The extracted proteins were determined by a bicinchoninic acid kit (Sigma-Aldrich; Merck KGaA). Subsequently protein (45 µg per lane) was subjected to 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat milk at the room temperature for 1 h, and incubated with antibodies against RCN2 (cat. no. ab231912), matrix metalloproteinase (MMP)-2 (cat. no. ab37150), β-catenin (cat. no. ab6302), cyclin D1 (cat. no. ab1663), C-myc (cat. no. ab32072), GAPDH (cat. no. ab181602) and β-actin (cat. no. ab8226) at a dilution of 1:1,000 (all Abcam, Cambridge, MA, USA) overnight at 4°C. Following washing five times (5 min each), the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (cat. no. ab6940; Abcam) at a dilution of 1:2,000 with secondary antibody dilution buffer (cat. no. P0023D; Beyotime Institute of Biotechnology, Shanghai, China) for 2 h at room temperature. The bands were visualized using a chemiluminescence detection kit (Nanjing KeyGen Biotech Co., Ltd.) and analyzed using Image J version 1.8.0 (National Institutes of Health, Bethesda, MD, USA).

Human RCN2 cDNA containing wild-type (wt) and mutant (mut) target sites for miR-183-5p was chemically synthesized and inserted into a pMIR-REPORT™ vector (Shanghai GeneChem Co., Ltd.). The pMIR-REPORT™ β-galactosidase control vector (Shanghai GeneChem Co., Ltd.) was used as a reference. 293 cells were seeded and cultured in 6-well plates at a density of 1.2×10⁶ cells per well. Then they were co-transfected with miR-183-5p mimics or inhibitor and wt or mut reporter plasmid using the Lipofectamine^® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.). A Dual Luciferase Reporter Gene Assay System D0010-100T, (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) was used to analyze the luciferase activity at 48 h post-transfection according to the manufacturer's protocol. The relative luciferase activity was calculated as the ratio of firefly luciferase activity vs. Renilla luciferase activity.

In the present study, CoGeMiR (release v1.2b, June 2008) was used to calculate the conservation levels of miR-183-5p (18). miRanda (http://www.miranda-im.org/, release IM vo.10.78, April 2018), miRDB (release 5.0 August 2014) and TargetScan (http://www.targetscan.org/, release 7.2, March 2018) were used to identify the proteins that may potentially interact with miR-183-5p, the specific methods being based on previous studies (19,20).

SPSS software (version 17.0; SPSS, Inc., Chicago, IL, USA) was used to analyze the data. Data were presented as the mean ± standard deviation. All the experiments were performed in triplicate and repeated three times. The significant differences between different groups were analyzed using an independent-samples t-test (comparison between two groups). Comparisons among more than two groups were performed with one-way analysis of variance and multiple comparisons between the groups were performed using the Student-Newman-Keuls method. P<0.05 was considered to indicate a statistically significant difference.

To study the role of miR-183-5p in CRC, bioinformatics analysis was performed to identify its biological features and potential function. RT-qPCR was performed to determine the expression of miR-183-5p in 45 CRC tissues and their adjacent normal colorectal tissues, and miR-183-5p was significantly upregulated in the CRC tissues compared with the adjacent normal tissues (Fig. 1A). The expression of miR-183-5p was also examined in normal colorectal cells (CCD-18Co) and CRC cell lines (HT-29, SW116, HCT116, SW480 and SW620), and the expression of SW620 in CRC cells was observed to be the most significantly increased compared with CCD-18Co cells (Fig. 1B).

To further investigate the function of miR-183-5p in CRC, a variety of in vitro assays were performed, including MTT proliferation and Transwell invasion/migration assays. The knockdown of miR-183-5p was verified through RT-qPCR, and the expression of miR-183-5p was significantly downregulated (Fig. 2A). The present results demonstrated that the downregulation of miR-183-5p inhibited SW620 cell proliferation, which was consistent with the corresponding MTT assay results (Fig. 2B), and it contributed to the suppression of the number of invasive and migratory cells (Fig. 2C). The findings indicated that the inhibition of miR-183-5p suppressed CRC cell proliferation, invasion and migration, and may be a potential therapeutic target for CRC.

To further investigate the possible mechanism of action of miR-183-5p in CRC (Fig. 3), a combination of TargetScan, miRanda and miRDB was used to predict the genes that interacted with miR-183-5p. Among the potential targets of miR-183-5p, the present study focused on RCN2, which exhibited the capability to bind to miR-183-5p (Fig. 3A). To further confirm the interaction between RCN2 and miR-183-5p, mimics were used to overexpress miR-183-5p (Fig. 3B). The wt RCN2 and mut RCN2 reporter vectors were constructed to perform the luciferase reporter assay. The luciferase activity of wt RCN2 was increased in the miR-183-5p mimics group, while the transfection with miR-183-5p inhibitors decreased the luciferase activity of wt miR-183-5p. In addition, miR-183-5p mimics or miR-183-5p inhibitors had no significant effect on the luciferase activity of mut RCN2 (Fig. 3C). Furthermore, the overexpression of miR-183-5p in SW620 cells increased the expression of RNC2 compared with the control group; the expression of RCN2 was decreased when miR-183-5p was downregulated in SW620 cells, compared with the control group (Fig. 3D). To investigate whether the effects of miR-183-5p were dependent on RCN2, co-transfection with miR-183-5p inhibitor and RCN2 overexpression adenovirus or siRNA was performed. The overexpression and knockdown efficiency of RCN2 are presented in Fig. 3G. As demonstrated in Fig. 3F, miR-183-5p knockdown significantly increased the percentage of CRC cells in the S phase, which was reversed by the over-expression of RCN2, and the percentage of CRC cells in the S phase was also increased to a greater extent following RCN2 silencing. It was also observed that the overexpression of RCN2 reversed the anti-proliferative and anti-invasive effect of miR-183-5p knockdown in SW620 cells. The results also demonstrated that co-transfection with miR-183-5p inhibitor and RCN2 siRNA further inhibited cell proliferation, invasion and migration (Fig. 3E and H).

In the present study, miR-183-5p was overexpressed to verify the role of miR-183-5p in CRC. MTT assays showed that miR-183-5p overexpression promoted CRC cell proliferation, and RCN2 knockdown led to a decrease in proliferation in CRC cells in which miR-183-5p was overexpressed (Fig. 4A). The upregulation of miR-183-5p significantly inhibited the percentage of CRC cells in the S phase, an effect which was reversed by the downregulation of RCN2 (Fig. 4B). The Transwell assay results illustrated that the increased migratory and invasive potential of miR-183-5p-overexpressed cells was rescued by RCN2 silencing in SW480 cells (Fig. 4C). Notably, the overexpression of RCN2 did not further increase the proliferation, invasion and migration of miR-183-5p-treated cells (data not shown).

The aforementioned results demonstrated that miR-183-5p was positively associated with RCN2 levels, and that the downregulation of miR-183-5p inhibited the proliferation and invasion of CRC cells. However, its potential molecular mechanisms remain unknown. The Wnt/β-catenin pathway serves an important role in the development of tumors. A recent study reported that miR-183 may have an inhibitory effect in osteosarcoma by regulating Wnt/β-catenin (9). Therefore, the present study aimed to investigate the effects of miR-183-5p on Wnt/β-catenin pathway downstream genes, including cyclin D1, c-Myc and MMP-2, in the SW620 cell line. β-Catenin protein and its downstream targets, cyclin D1, c-Myc and MMP-2, were all demonstrated to be reduced in CRC cells in which miR-183-5p or RCN2 were downregulated (Fig. 5). These data suggested that miR-183-5p downregulation inhibits CRC cell proliferation, invasion and migration by blocking the Wnt/β-catenin pathway.