The present study aimed to investigate the effects of propofol on neonatal acute lung injury (ALI) in a rat model and to examine the molecular mechanisms underlying propofol function. A rat model of ALI was established by intraperitoneal injection of lipopolysaccharides (LPS). The neonatal rats were treated with various concentrations of propofol and a lung injury score was assessed. The protein expression levels of pro-inflammatory cytokines was detected using ELISA. In the present study, oxidative stress was determined by measuring the level of malondialdehyde (MDA) and the activity of superoxide dismutase (SOD) in lung tissues. Reverse transcription quantitative-polymerase chain reaction and western blot analysis were used to examine the mRNA and protein expression levels of the factors downstream to LPS signaling pathway. Treatment with propofol significantly alleviated LPS-induced lung injury in neonatal rats as suggested by the decreased lung injury score, increased partial pressure of oxygen and decreased lung wet-dry weight ratio. LPS promoted the upregulation of tumor necrosis factor α (TNF-α), interleukin (IL)-6 and IL-1β in lung tissues and bronchoalveolar lavage fluid from neonatal rats exhibiting ALI. Notably, treatment with propofol decreased the expression levels of these factors. Additionally, LPS caused an increase in the levels of MDA, and a decrease in SOD activity, and treatment with propofol suppressed these effects in a dose-dependent manner. Furthermore, LPS induced the upregulation of phosphorylated (p-)p38, nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB), p-p65, NLR family pyrin domain containing 3 (NLRP3), apoptosis-associated speck-like protein containing CARD and caspase-1 in lung tissues of neonatal rats, and treatment with propofol was able to downregulate these factors in a dose-dependent manner. Propofol alleviated lung injury in neonatal rats with LPS-induced ALI by preventing inflammation and oxidative stress via the regulation of the activity of the p38 mitogen-activated protein kinase/NF-κB signaling pathway and the expression levels of the NLRP3 inflammasome.
Acute lung injury (ALI) is a disorder associated with pulmonary inflammation that may lead to increased permeability syndrome (
Lipopolysaccharides (LPS) are bacterial bioactive components involved in various pathological conditions and are able to promote the inflammatory cascade (
Propofol is used to induce or maintain anesthesia (
The mechanism underlying propofol effect on lung injury remains unclear. Specifically, to the best of the authors' knowledge, the effect of propofol on neonatal ALI has not been examined. The present study aimed to investigate the role of propofol on neonatal ALI and the molecular mechanism underlying its effects.
A total of 30 male newborn Sprague-Dawley rats (age, 3–8 days; weight, 8–14 g) were obtained from the Animal Experimental Center of Zhejiang University (Hangzhou, China). All experimental procedures were performed according to the Recommended Guidelines for the Care and Use of Laboratory Animals issued by The Chinese Council on Animal Research (
To induce ALI, rats were injected intraperitoneally with LPS (3 mg/kg; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) as previously described (
To perform the assessment of the lung injury score, lung tissues were collected from the control and the three experimental groups. Lung tissues were fixed with 10% neutral phosphate-buffered formalin at 4°C for 24 h, embedded in paraffin and sectioned (4 µm). Subsequently, hematoxylin and eosin staining was conducted using standard protocols. The pathological alterations in the morphology of lung tissues were observed under a light microscope (magnification, ×200). The lung injury score was assessed to quantify the lung injury. Lung injury scores were calculated by summing the degree of cell infiltration and the severity score of tissue damage assessed from the lung sections (
Rats were anesthetized with 3% isoflurane. Blood samples (200 µl) were collected from abdominal aorta, and an automatic blood gas analyzer (Cobas B123; Roche Diagnostics, Basel, Switzerland) was used to measure the partial pressure of oxygen (PaO2). The rats were sacrificed and the right lungs were collected from the control and the three experimental groups. Subsequently, the wet weights (W) of the right lungs were measured. Subsequently, following a 48-h incubation at 70°C, the dry weights (D) of the right lungs were measured and the wet-dry weight ratio (W/D) was calculated.
The bronchoalveolar lavage fluid (BALF) was obtained by intratracheal instillation of sterile PBS, repeated three times. The BALF supernatant was collected by centrifugation (800 × g) at 4°C for 10 min. ELISA kits (Wuhan Boster Biological Technology, Ltd., Wuhan, China) were used to detect the levels in BALF of the following pro-inflammatory cytokines: Tumor necrosis factor α (TNF-α; cat. no. EK0526), interleukin (IL)-1β (cat. no. EK0393) and IL-6 (cat. no. EK0412). The level of malondialdehyde (MDA) and the activity of superoxide dismutase (SOD) in lung tissues were determined using commercially available kits (cat. nos. A003-1 and A001-3; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's protocol.
Total RNA was isolated from lung tissues by using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. An equal amount of RNA from various groups was reversely transcribed into cDNA using PrimeScript™ RT reagent kit (Takara Bio Inc., Otsu, Japan) according to the manufacturer's protocol. qPCR was performed using SYBR® Premix Ex Taq™ II (Takara Bio Inc.). Thermocycling conditions were: 95°C for 5 min, 40 cycles at 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec and then 72°C for 10 min. GAPDH was used as endogenous control. Primer sequences are presented in
Total proteins from whole tissue lysates were extracted using radioimmunoprecipitation assay buffer (cat. no. P0013B; Beyotime Institute of Biotechnology, Nanjing, China), and a bicinchoninic acid assay kit was used to quantify protein concentration. A total of 25 µg protein was loaded per lane, in a volume of 20 µl. Proteins were separated by 12% SDS-PAGE, and subsequently transferred onto polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA), and blocked with 5% skim milk for 1 h at room temperature. The membranes were incubated at 4°C overnight with one of the following primary antibodies: TNF-α (cat no. ab13597; 1:1,000; Abcam, Cambridge, MA, USA), IL-1β (cat no. ab200478; 1:1,000; Abcam), IL-6 (cat no. ab9324; 1:1,000; Abcam), phosphorylated (p-)p38 (cat no. ab45381; 1:1,000; Abcam), p38 (cat no. ab31828; 1:1,000; Abcam), p-p65 (cat no. ab86299; 1:1,000; Abcam), p65 (cat no. ab16502; 1:1,000; Abcam), NLRP3 (cat no. ab214185; 1:1,000; Abcam), ASC (at no. sc-514414; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), caspase-1 (cat no. ab1872; 1:1,000; Abcam) and β-actin (cat no. 4970; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA). Subsequently, the membranes were incubated with the anti-rabbit immunoglobulin G horseradish peroxidase-labeled secondary antibody (cat no. 7074; 1:2,000; Cell Signaling Technology, Inc.) at room temperature for 2 h. Enhanced chemiluminescence reagents (EMD Millipore) were used to visualize the protein bands. The intensity of p-p38 and p-p65 was analyzed using Gel-Pro-Analyzer software version 4.0 (Media Cybernetics, Inc., Rockville, MD, USA).
Data are presented as the mean ± standard deviation. SPSS statistical software (version 16.0; SPSS, Inc., Chicago, IL, USA) was used to conduct statistical analyses. One-way analysis of variance followed by Student-Newman-Keuls post hoc test was performed to determine differences between groups. P<0.05 was considered to indicate a statistically significant difference.
Treatment with propofol decreased the lung injury score in a dose-dependent manner in ALI Model rats, which was significantly increased upon treatment with LPS (
Inflammation serves an important role in the initiation and maintenance of ALI (
The effects of propofol on the oxidative stress induced by ALI were examined. Compared with the control group, treatment with LPS significantly decreased the activity of SOD and increased the level of MDA in lung tissues (
The expression level of pro-inflammatory cytokines is regulated at the transcriptional level by the MAPK and NF-κB signaling pathways, and previous studies demonstrated that the p38 MAPK/NF-κB pathway is active during ALI (
The NLRP3 inflammasome serves an important role in regulating the inflammatory response and oxidative stress (
In the present study, treatment with propofol was identified to relieve LPS-induced pulmonary edema and to inhibit LPS-mediated inflammatory response and oxidative stress in neonatal rats. In addition, the present findings suggested that treatment with propofol inhibited the activation of the p38-MAPK/NF-κB pathway and NLRP3 inflammasome. These results suggested that treatment with propofol may alleviate ALI induced by LPS administration.
Pediatric ALI is one of the most common causes of infant mortality, as newborns are more vulnerable than adults (
As one of the early symptoms of multiple organ failure, the onset of ALI is associated with increased circulation levels of endotoxin or LPS (
The effects of propofol on the protein expression levels of certain inflammatory factors were examined in neonatal rats with ALI. The present results suggested that propofol decreased the protein expression levels of TNF-α, IL-6 and IL-1β that were increased by LPS in neonatal rats, which is consistent with a previous study (
To investigate the molecular mechanism underlying the effects of propofol on neonatal ALI, the present study analyzed the p38 MAPK/NF-κB pathway and NLRP3 inflammasome, which were previously identified to serve important roles in the regulation of the inflammatory response and to be regulated by propofol (
However, due to its rapid onset and short elimination half-life, propofol is considered an addictive substance with sedative and relaxing effects, and the recreational abuse of this drug has increased over the past years (
In summary, the present study suggested that treatment with propofol may relieve LPS-induced pulmonary edema, inhibit LPS-associated inflammatory response and oxidative stress in neonatal rats by repressing the activation of the p38 MAPK/NF-κB signaling pathway and the NLRP3 inflammasome. Propofol served a protective role in neonatal ALI induced by LPS, and it may represent a promising therapeutic agent for the treatment of neonatal ALI.
The authors would like to thank Dr Deng Xingmei from The Department of Paediatrics, Maternal and Child Health-Care Hospital for his help.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XY was responsible for study design, data access and analysis, interpretation of results and preparation of the manuscript. CL was responsible for interpretation of results and preparation of the manuscript.
All experimental procedures were performed according to the Recommended Guidelines for the Care and Use of Laboratory Animals issued by The Chinese Council on Animal Research. The present study was approved by The Animal Ethics Committee of The Maternal and Child Health-Care Hospital of Qujing (Qujing, China).
Not applicable.
The authors declare that they have no competing interests.
Propofol relieves the pulmonary edema induced by LPS in neonatal rats. (A) Lung injury scores in neonatal rats with LPS-induced acute lung injury treated with various concentration of propofol. (B) PaO2 in arterial blood samples collected from neonatal rats treated with LPS and propofol. (C) Lung W/D in neonatal rats treated with LPS and propofol. **P<0.01 vs. control group; #P<0.05, ##P<0.01 vs. LPS group. LPS, lipopolysaccharides; PaO2, partial pressure of oxygen; W/D, wet-dry weight ratio.
Propofol prevents the inflammatory response induced by LPS in neonatal rats. Protein expression level of (A) TNF-α, (B) IL-6 and (C) IL-1β in bronchoalveolar lavage fluid collected from neonatal rats treated with LPS and propofol. **P<0.01 vs. control group; #P<0.05, ##P<0.01 vs. LPS group. LPS, lipopolysaccharides; TNF-α, tumor necrosis factor α; IL, interleukin.
Propofol decreases the expression levels of inflammatory cytokines promoted by LPS in neonatal rats. (A) Protein expression level of TNF-α, IL-6 and IL-1β in lung tissues collected from neonatal rats treated with LPS and propofol. mRNA expression level of (B) TNF-α, (C) IL-6 and (D) IL-1β in lung tissues collected from neonatal rats treated with LPS and propofol. **P<0.01 vs. control group; #P<0.05, ##P<0.01 vs. LPS group. LPS, lipopolysaccharides; TNF-α, tumor necrosis factor α; IL, interleukin.
Propofol prevents the oxidative stress induced by LPS in neonatal rats. (A) SOD activity in lung tissues collected from neonatal rats treated with LPS and propofol. (B) Concentration of MDA in lung tissues collected from neonatal rats treated with LPS and propofol. **P<0.01 vs. control group; #P<0.05, ##P<0.01 vs. LPS group. LPS, lipopolysaccharides; SOD, superoxide dismutase; MDA, malondialdehyde.
Propofol prevents the activation of the p38 mitogen-activated protein kinase/nuclear factor κ-light-chain-enhancer of activated B cells signaling pathway induced by LPS in neonatal rats. (A) Protein expression levels of p-p38, p38, p65 and p-p65 in lung tissues collected from neonatal rats treated with LPS and propofol were detected by western blot assay. The ratio of (B) p-p38/p38 and (C) p-p65/p65 in lung tissues collected from neonatal rats treated with LPS and propofol. **P<0.01 vs. control group; #P<0.05, ##P<0.01 vs. LPS group. ASC, apoptosis-associated speck-like protein containing CARD; LPS, lipopolysaccharides; NLRP3, NLR family pyrin domain containing 3; p-, phosphorylated.
Propofol prevents the activation of the NLRP3 inflammasome induced by LPS in neonatal rats. (A) Protein expression levels of NLRP3, ASC and caspase-1 in lung tissues collected from neonatal rats treated with LPS and propofol were detected by western blot assay. mRNA expression levels of (B) NLRP3, (C) ASC and (D) caspase-1 in lung tissues collected from neonatal rats treated with LPS and propofol were analyzed using reverse transcription quantitative-polymerase chain reaction. *P<0.05, **P<0.01 vs. control group; #P<0.05, ##P<0.01 vs. LPS group. ASC, apoptosis-associated speck-like protein containing CARD; LPS, lipopolysaccharides; NLRP3, NLR family pyrin domain containing 3.
Primer sequences used for the reverse transcription quantitative-polymerase chain reaction.
Gene | Primer sequence (5′→3′) |
---|---|
TNF-α | F: CCTCTTCTCATTCCTGCTC |
R: CTTCTCCTCCTTG TTGGG | |
IL-1β | F: TGTGAAATGCCACCTTTTGA |
R: TGAGTGATACTGCCTGCCTG | |
IL-6 | F: CCGGAGAGGAGACTTCACAG |
R: CAGAATTGCCATTGCACA | |
NLRP3 | F: GATCTTCGCTGCGATCAACAG |
R: CGTGCATTATCTGAACCCCAC | |
ASC | F: GCAATGTGCTGACTGAAGGA |
R: TGTTCCAGGTCTGTCACCAA | |
Caspase-1 | F: GCACAAGACCTCTGACAGCA |
R: TTGGGCAGTTCTTGGTATTC | |
GAPDH | F: CTTTGGTATCGTGGAAGGACTC |
R: GTAGAGGCAGGGATGATGTTCT |
ASC, apoptosis-associated speck-like protein containing CARD; F, forward; IL, interleukin; NLRP3, NLR family pyrin domain containing 3; R, reverse; TNF-α, tumor necrosis factor-α.