Our previous study reported that fully reduced high mobility group box 1 (fr-HMGB1) and disulfide HMGB1 (ds-HMGB1) induce depressive-like behavior; however, the underlying mechanisms remain unclear. In the present study, the induction of depression via the kynurenine pathway by different redox states of HMGB1 was investigated
The alarmin protein, high mobility group box-1 (HMGB1), exhibits varying biological activities depending on its location and state (
Previously, Frank
The serotonin hypothesis, which suggests that low serotonin levels cause depression, was proposed in the 1960s (
The present study aimed to investigate the mechanisms by which HMGB1 may directly induce depressive-like behavior and determine the state in which it induces its effects.
In the present study, a total of 20 8-week-old male mice (BALB/c, 22–25 g) were obtained from the Animal Center of the Second Military Medical University (Shanghai, China). Prior to experiments, mice were adapted to housing conditions (temperature, 20±1°C; humidity, 52±2%; 12:12-h light/dark cycle; access to water and food
Intracerebroventricular injections were performed as previously described (
All behavioral tests were performed during the dark phase (07:00 p.m.-09:00 p.m.). The sucrose preference test (SPT), tail suspension test (TST) and open field test (OFT) were used as behavioral parameters to evaluate depression-like behavior as previously described (
Ds-HMGB1 (cat. no. HM-122), fr-HMGB1 (cat. no. HM-116) and nonoxid-HMGB1 (cat. no. HM-132) were purchased from HMGBiotech. DMEM containing 4.5 g/l D-glucose and L-glutamine (cat. no. 11965-092) and heat inactivated horse serum (cat. no. 26050-070) were obtained from Gibco (Thermo Fisher Scientific, Inc.). Hank's balanced salt solution (HBSS; cat. no. B410) was purchased from BasalMedia.
Hippocampi from 7-day-old BALB/c pups (20 mice; Animal Center of the Second Military Medical University) were obtained for OHSCs as previously described (
Total RNA was extracted from mouse tissues and OHSCs using TRNzol-A+ reagent (cat. no. DP421; Tiangen Biotech Co., Ltd.) and reverse transcribed into cDNA using a PrimeScript™ RT Master Mix (Perfect Real Time) kit (cat. no. RR036A; Takara Bio, Inc.). RT solution was prepared on ice, and RT was performed at 37°C for 15 min and 85°C for 5 sec, and cDNA was stored at 4°C. Forward and reverse primer sequences are presented in
The proteins extracted from mouse hippocampi were blended in microfuge tubes with 25 mg tissue/0.25 ml RIPA buffer containing 1 mM PMSF protease inhibitor (Beyotime Institute of Biotechnology). The samples were kept on ice for 30 min and centrifuged at 10,000 × g for 5 min at 4°C before the lysate supernatants were collected. The protein concentration was determined using a BCA Protein Assay kit (cat. no. P0010, Beyotime Institue of Biotechnology). Samples containing equal quantities of protein (20 µg) were separated via SDS-PAGE on 10% gels and transferred onto polyvinylidene fluoride membranes. The membranes were blocked by 5% nonfat dried milk in TBS-0.1% Tween-20 at room temperature for 1 h and incubated overnight at 4°C with the following primary antibodies from ProteinTech Group, Inc.: Anti-GAPDH (1:2,000; cat. no. 10494-1-AP); anti-IDO (1:200; cat. no. 66528-1-lg); anti-KMO (1:500; cat. no. 10698-1-AP); anti-KYNU (1:1,000; cat. no. 11796-1-AP) and anti-KAT2 (1:800; cat. no. 14983-1-AP). Following incubation with the secondary antibody [IRDye-conjugated anti-rabbit (cat. no. 926-32211) and anti-mouse (cat. no. 926-68070) immunoglobulin G; 1:5,000; LI-COR Biosciences)] for 1 h at room temperature, the membranes were scanned. The integrated optical density (IOD) was calculated by use of an Odyssey Infrared Imaging System (LI-COR Biosciences) and ImageJ software (1.48v; National Institutes of Health).
The concentrations of tumor necrosis factor-α (TNF-α; cat. no. F11630) and interleukin-1β (IL-1β; cat. no. F10770) in the OHSC supernatant were detected using corresponding ELISA kits according to the manufacturer's protocols (Westang, Inc.). Briefly, 100 µl of each sample was added to ELISA plates in duplicate. The lower limits of detection were 4 pg/ml for TNF-α and 8 pg/ml for IL-1β. The absorbance was measured on a microplate reader (Synergy™ H1; BioTek Instruments, Inc.).
Hippocampal ROS levels were measured in hippocampal lysates using the OxiSelect™
Following the completion of all behavioral tests, mice were intraperitoneally anesthetized using 4% chloral hydrate (400 mg/kg, intraperitoneal administration) and perfused transcardially with 0.9% saline followed by ice-cold 4% paraformaldehyde (PFA; cat. no. G1101; Wuhan Servicebio Technology Co., Ltd.). Following fixation for 4–8 h fix in 4% PFA, brains were dehydrated in 20% sucrose for 2–3 days. The brains were then embedded in paraffin and sectioned (4 µm). Prior to assays, sections were deparaffinized in xylene and rehydrated in a graded ethanol series. In brief, slices were incubated with 20 µM dihydroethidium (DHE; cat. no. D7008; Sigma-Aldrich; Merck KGaA) for 30 min at 37°C, followed by incubation with DAPI (1:1,000; cat. no. D9542; Sigma-Aldrich; Merck KGaA) for 10 min at room temperature. Images were obtained using a fluorescence microscope (magnification, ×200; Carl Zeiss AG) at an excitation wavelength of 370 nm and emission wavelength of 420 nm.
GraphPad Prism 6.01 (GraphPad Software, Inc.) was used for data analysis. Two-way ANOVA with post hoc Tukey's multiple comparison test was performed to evaluate the main effects and interactions of fr-HMGB1 and H2O2
Several behavioral tests were conducted to evaluate the depressive-like behavior of mice following administration of recombinant HMGB1, including fr-HMGB1, ds-HMGB1 and nonoxid-HMGB1. Nonoxid-HMGB1, in which all cysteines are replaced by serine residues, is a mutant analogue of fr-HMGB1 (
Sucrose preference was significantly decreased following injection of fr- (P<0.05) and ds-HMGB1 (P<0.01) compared with control treatment (F=8.665, P=0.0012;
As described, ds-HMGB1 and fr-HMGB1 contributed to depressive-like behavior, whereas nonoxid-HMGB1 did not. The mRNA expression and relative protein levels of essential KYN pathway enzymes in the hippocampus were analyzed following intracerebroventricular administration of various HMGB1 forms.
As presented in
In addition to detecting the mRNA expression of KYN pathway-associated enzymes, their relative protein expression was also determined. As presented in
To further investigate the varied effects of fr- and ds-HMGB1 on the KYN pathway, essential proteins of the KYN pathway were evaluated following treatment of OHSCs with fr- and ds-HMGB1
To determine the mechanism by which fr-HMGB1 induces the KYN pathway
It has been reported that central inflammatory cytokine levels are increased during the development of depressive-like behavior (
Consistent with our previous study (
As aforementioned, HMGB1 exists in three different forms. Its biological activities rely on these forms, which vary based on the oxidation states of cysteine residues at C23, C45 and C106 (
Of note, fr-HMGB1 also induced the KYN pathway, upregulating cytokines such as TNF-α
The present study revealed that ds-HMGB1 and fr-HMGB1 activated the KYN pathway. As aforementioned, Trp metabolism by IDO or TDO2 is the first step of the KYN pathway; when Trp is converted into KYN, it can be metabolized by KMO, KYUN and 3-HAO to yield 3-HK, QUIN and NAD+; alternatively, it can be converted into KYNA by KAT2. Of note, KYN derivatives in the Trp-NAD+ pathway include neurotoxic compounds such as 3-HK and QUIN (
The effects of HMGB1 have been reported in numerous diseases, including sepsis, arthritis and ischemia-reperfusion, with the application of HMGB1-blocking therapies improving symptoms in rodent models of these disorders (
The present study investigated the role of fr-HMGB1 in the induction KYN pathway; however, the role of other mechanisms cannot be excluded. Additionally, the effects of systemic ROS depletion using antioxidant compounds or vitamins supplements, and the measurement of antioxidant enzyme levels or KYN pathway metabolites
The authors would like to thank Dr Huang Xiao (Institute of Neuroscience and Key Laboratory of Molecular Neurobiology of Ministry of Education, Second Military Medical University, Shanghai, China) for technical assistance and editing of the manuscript.
The present study was financially supported by the National Natural Science Foundation of China (grant nos. 81171124 and 81771301).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
BW drafted the manuscript and contributed to all aspects of the experimental design and research procedure, including western blotting and qPCR assays. YJL was involved in conducting the behavioral measurements. LLL and JML contributed to conducting the experiments. WJS and CLJ made substantial contributions to the conception of the study and the editing of the manuscript. YXW was involved in designing the study and interpreting the data. All authors read and approved the final manuscript.
The present study was approved by the Committee on Ethics of Biomedicine Research, Second Military Medical University and conducted in accordance with the guidelines of Animal Experimentation set by the committee.
Not applicable.
The authors declare that they have no competing interests.
Coordinates of intracerebral ventricular injection. The cannula tip was placed at the following stereotaxic coordinates: Anteroposterior: −0.6 mm; mediolateral: −1.1 mm; dorsoventral: −2 mm.
HMGB1 at different redox states induces distinct effects on the development of depressive-like behavior in mice. Effects of fr-, ds- and nonoxid-HMGB1 on (A) sucrose preference and (B) duration of immobility in the TST. Effects of HMBG1 on (C) total distance and (D) central distance traveled in the open field test. Data are presented as the mean ± SEM (n=5/group). *P<0.05, **P<0.01, ***P<0.001. ds-, disulfide; fr-, fully reduced; HMGB1, high mobility group box-1; nonoxid-, non-oxidizable chemokine; TST, tail suspension test.
Expression levels of enzymes in the kynurenine pathway are increased in fr-HMGB1 and ds-HMGB1-treated mice. (A) Gene expression levels of IDO, KMO, KYNU, KAT2 and 3-HAO relative to control samples, as determined via reverse transcription-quantitative PCR analysis. Representative western blots of the protein levels of (B) IDO and KMO, (C) KAT2 and KYNU in hippocampi. (D) Semi-quantification of protein expression. Data are presented as the mean ± SEM (n=5/group). *P<0.05, **P<0.01. ds-, disulfide; fr-, fully reduced; HMGB1, high mobility group box-1; IDO, indoleamine-2,3-dioxygenase; KAT2, kynurenine aminotransferase 2; KMO, kynurenine monooxygenase; KYNU, kynureninase; nonoxid-, non-oxidizable chemokine; 3-HAO, 3-hydroxyanthranilate 3,4-dioxygenase.
Oxidized fr-HMGB1 induces the kynurenine pathway in cultured hippocampus slices. Gene expression levels of IDO, KMO, KYNU, KAT2 and 3-HAO in OHSCs treated with (A) fr- and ds-HMGB1, and (B) fr-HMGB1 and H2O2, as determined via reverse transcription-quantitative PCR analysis. Data are presented as the mean ± SEM (n=3-5/group). *P<0.05, **P<0.01, ***P<0.001 vs. Control. ds-, disulfide; fr-, fully reduced; HMGB1, high mobility group box-1; IDO, indoleamine-2,3-dioxygenase; KAT2, kynurenine aminotransferase 2; KMO, kynurenine monooxygenase; KYNU, kynureninase; 3-HAO, 3-hydroxyanthranilate 3,4-dioxygenase.
TNF-α and IL-1β levels in tissue slices and ROS production in the hippocampus. (A and B) ROS levels in the hippocampus, as determined in brain slices by dihydroethidium fluorescence and in hippocampal lysates by DCF fluorescence. (C) Following the treatment of organotypic hippocampal slice cultures for 6 h with fr-HMGB1 and H2O2, supernatants were collected and tested for TNF-α and IL-1β protein levels. Data are presented as the mean ± SEM (n=3-5/group). *P<0.05, **P<0.01, ***P<0.001 vs. Control. DCF, dichlorodihydrofluorescein; fr-, fully reduced; HMGB1, high mobility group box-1; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α.
Model of fr- and ds-HMGB1-mediated neurotoxicity. Ds-HMGB1 upregulated the expression of certain enzymes associated with the kynurenine pathway mainly located in microglia but not in astrocytes; fr-HMGB1 induced similar effects following oxidation. It was hypothesized that the disbalance of the two kynurenine pathway arms in the brain reinforced neurotoxic metabolite neurotransmission, inhibited the production of neuroprotective compounds and contributed to the occurrence of depression. ds-, disulfide; fr-, fully reduced; HMGB1, high mobility group box-1; IDO, indoleamine-2,3-dioxygenase; KAT2, kynurenine aminotransferase 2; KMO, kynurenine monooxygenase; KYN, kynurenine; KYNA, kynurenic acid; KYNU, kynureninase; 3-HAO, 3-hydroxyanthranilate 3,4-dioxygenase; Trp, tryptophan.
Target genes analyzed via reverse transcription-quantitative PCR.
Gene name | Primer sequence (5′→3′) | Function |
---|---|---|
IDO | F: GCTTTGCTCTACCACATCCAC | Oxidation, Trp→KYN |
R: CAGGCGCTGTAACCTGTGT | ||
KAT2 | F: ATGAATTACTCACGGTTCCTCAC | Cleavage, KYN→KYNA |
R: AACATGCTCGGGTTTGGAGAT | ||
KMO | F: ATGGCATCGTCTGATACTCAGG | Oxidation, KYN→3-HK |
R: CCCTAGCTTCGTACACATCAACT | ||
KYNU | F: AGTGGGCTGCACTTTTATACTG | Conversion, 3-HK→3-HANA |
R: TGCAAACAGGTTGCCTTTCAG | ||
3-HAO | F: GAACGCCGTGTGAGAGTGAA | Oxidation, 3-HANA→QUIN |
R: CCAACGAACATGATTTTGAGCTG | ||
β-actin | F: TTCTTGGGTATGGAATCCTGT | Cytoskeleton |
R: AGCACTGTGTTGGCATAGAG |
F, forward; R, reverse; IDO, indoleamine-2,3-dioxygenase; KAT2, kynurenine aminotransferase 2; KMO, kynurenine monooxygenase; KYN, kynurenine; KYNA, kynurenic acid; KYNU, kynureninase; Trp, tryptophan; 3-HAO, 3-hydroxyanthranilate 3,4-dioxygenase; 3-HANA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine.