Primary rat cerebral cortical neurons were extracted from Sprague-Dawley rat embryos (n=5) at embryonic day 16–18 as previously described (25,26). In brief, brain cortex tissues were extracted and dissected in Hanks' balanced salt solution (HBSS), cut into ~1 mm³ cubes, washed with HBSS, and then digested with 0.25% trypsin (37°C for 15 min). Then, DMEM-F12 (Gibco; Thermo Fisher Scientific, Inc.) with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) was used to stop trypsin digestion. The dissociated cells were seeded in 24-well plates and cultured for 24 h at 37°C. Then, the cells were cultured in neurobasal medium (Gibco; Thermo Fisher Scientific, Inc.) containing 2% B-27, 2 mM glutamine and 50 ug/ml gentamycin, and cells were incubated at 37°C with 5% CO₂. Sprague-Dawley rats were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., and housed at 25±5°C with 50% humidity under a 12:12-h dark/light cycle. Rats accessed to food and water ad libitum. Animal experiments were conducted according to the the guidelines of the National Institutes of Health for the Care and Use of Laboratory Animals (27). The present study was approved by the Animal Ethics Committee of the First People's Hospital of Wenling (Wenling, China).

The OGD/R model was established in the present study as previously described (26). In brief, cortical neurons were plated into 6-well plates at a density of 5×10⁵ cells/ml (2 ml) and cultured overnight. Then, the neurons were incubated in glucose-free DMEM in a hypoxic incubator chamber (1% O₂, 5% CO₂ and 94% N₂) at 37°C for 6 h. After three washes with DMEM, cells were incubated in DMEM supplemented with 4.5 g/l glucose at 37°C with 5% CO₂ for 24 h.

The same treatment was performed in the control group without OGD/R exposure. Briefly, neurons in the control group were cultured in DMEM under standard conditions for 6 h. After three washes with DMEM, cells were incubated in DMEM at 37°C with 5% CO₂ for 24 h.

Cortical neurons were seeded in a 6-well plate (1×10⁶ cells/well) and incubated at 37°C for 24 h. Then, 100 nM miR-217 inhibitor (5′-UACUGCAUCAGGAACUGAUUGGA-3′; Bioneer Corp.), 100 nM inhibitor control (5′-GCCUCCGGCUUCGCACCUCU-3′; Bioneer Corp.), 2 µl control-small interfering RNA (siRNA; cat. no. sc-36869; Santa Cruz Biotechnology, Inc.), 2 µl sirtuin 1 (SIRT1)-siRNA (cat. no. sc-40986; Santa Cruz Biotechnology, Inc.) or 100 nM miR-217 inhibitor + 2 µl SIRT1-siRNA was transfected into the cells using Lipofectamine^® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. At 24 h after transfection, transfection efficiency was measured using reverse transcription-quantitative PCR (RT-qPCR). At 24 h following transfection with miR-217 inhibitor, inhibitor control, or miR-217 inhibitor+SIRT1-siRNA, cells were subjected to OGD/R induction.

Cell viability was determined at 24 h following OGD/R induction as previously described (26). Cell viability was determined via a CCK-8 assay. In brief, cells were plated into a 96-well plate (5×10³ cells/well) and incubated at 37°C overnight. Then, cells were transfected with or without miR-217 inhibitor, inhibitor control or miR-217 inhibitor + SIRT1-siRNA for 24 h (in equal quantities as aforementioned), followed by OGD/R treatment. Subsequently, 10 µl CCK-8 solution (cat. no. C0038; Beyotime Biotechnology) was added to each well and incubated for another 2 h at 37°C. At the end of the experiment, cell viability was calculated by measuring the absorbance at 450 nm using a FLUOstar^® Omega microplate reader (BMG Labtech GmbH).

The levels of tumor necrosis factor-α (TNF-α; cat. no. PT516), and interleukin (IL)-6 (cat. no. PI326) and IL-1β (cat. no. PI301; all Beyotime Institute of Biotechnology) in the supernatant of cells were measured via sandwich ELISAs according to the manufacturer's protocol.

An LDH Cytotoxicity Assay kit (cat. no. C0016; Beyotime Institute of Biotechnology) was used to determine cell injury according to the manufacturer's protocols. In brief, cells were lysed and then incubated with NADH and pyruvate at 37°C for 15 min. The absorbance value at a wavelength of 530 nm was determined using a FLUOstar Omega microplate reader.

To investigate the effects of miR-217 on the apoptosis of cortical neurons, an Annexin V-FITC/propidium iodide (PI) Apoptosis Detection kit (cat no. 70-AP101-100; MultiSciences Biotech Co., Ltd.) was using according to the manufacturer's protocols. Following the aforementioned treatments, cortical neurons were stained with 5 µl Annexin V-FITC and 5 µl PI for 30 min at room temperature in the dark. Subsequently, a flow cytometer (BD Biosciences) was used to analyze cell apoptosis. The apoptosis rate (early + late) was calculated (percentage of cells in the right quadrants) using WinMDI soft-ware (version 2.5; Purdue University Cytometry Laboratories).

To analyze the levels of ROS in cells, a Reactive Oxygen Species Assay Kit (cat. no. S0033; Beyotime Institute of Biotechnology) was used according to the manufacturer's protocols. A Total Superoxide Dismutase Assay kit with WST-8 (cat. no. S0101; Beyotime Institute of Biotechnology) was used to determine the level of SOD in cortical neurons according to the manufacturer's protocols. A Lipid Peroxidation MDA Assay kit (cat no. S0131; Beyotime Institute of Biotechnology) was used to determine the levels of MDA.

Proteins were extracted from cells using RIPA lysis buffer (cat no. P0013E; Beyotime Institute of Biotechnology) according to the manufacturer's protocols. A bicinchoninic acid assay kit (Pierce; Thermo Fisher Scientific, Inc.) was used to quantify the protein samples according to the manufacturer's protocols. Equal amounts of protein samples (25 µg/lane) were separated via SDS-PAGE on 12% gels, transferred onto polyvinylidene difluoride membranes (EMD Millipore), and blocked in 5% skim milk at room temperature for 1.5 h. Then, the membranes were incubated with primary antibodies against SIRT1 (1:1,000; cat. no. 9475; Cell Signaling Technology, Inc.), phosphorylated (p)-AMP-activated protein kinase-α (AMPK-α; 1:1,000; cat. no. 50081; Cell Signaling Technology, Inc.), AMPK-α (1:1,000; cat. no. 5831; Cell Signaling Technology, Inc.), NF-κB p65 (1:1,000; cat. no. 8242; Cell Signaling Technology, Inc.), p-p65 (1:1,000; cat. no. 3033; Cell Signaling Technology, Inc.), and β-actin (1:1,000; cat. no. 4970; Cell Signaling Technology, Inc.) overnight at 4°C, followed by incubation with the horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody (1:2,000; cat no. 7074; Cell Signaling Technology, Inc.) at room temperature for 2 h. Finally, protein blots were visualized using chemiluminescent ECL reagent (EMD Millipore) and quantified by densitometry (QuantityOne 4.5.0 software; Bio-Rad Laboratories, Inc.).

Total RNA was extracted from cells using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. A TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used for cDNA generation. Reaction conditions for RT were: 50°C for 5 min and 80°C for 2 min. An SYBR Premix Ex Taq™ II (TliRNaseH Plus) kit (Takara Bio, Inc.) was using to analyze the synthesized cDNAs. U6 and GAPDH were used as internal controls for miRNA and mRNA expression, respectively. Primer sequences for PCR were as follows: miR-217, forward, 5′-CGCAGATACTGCATCAGGAA-3′ and reverse, 5′-CTGAAGGCAATGCATTAGGAACT-3′; SIRT1, forward, 5′-AATCCAGTCATTAAACGGTCTACAA-3′ and reverse, 5′-TAGGACCATTACTGCCAGAGG-3′; U6, forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′CGCTTCACGAATTTGCGTGTCAT3′; and GAPDH, forward, 5′-CTTTGGTATCGTGGAAGGACTC-3′ and reverse, 5′-GTAGAGGCAGGGATGATGTTCT-3′. The thermocycling conditions were as follows: 95°C for 5 min, followed by 38 cycles of denaturation at 95°C for 15 sec and annealing/elongation at 60°C for 30 sec. The relative gene expression was calculated using the 2^−ΔΔCq method (28).

TargetScan bioinformatics software (release 7.1; www.targetscan.org/vert_71) was used to predict the targets of miR-217; a putative binding site between the 3′-UTR of SIRT1 and miR-217 was identified. Then, to determine whether miR-217 directly binds to SIRT1, the target sequence (WT-SIRT1; ATGCAGT) and a mutated sequence (MUT-SIRT1; TACGTCA) were synthesized. To point-mutate the miR-217 binding domain on the 3′-UTR of SIRT1, a QuikChange Site-Directed Mutagenesis kit (Stratagene; Agilent Technologies, Inc.) was used according to the manufacturer's protocols. Following digestion with XhoI and NotI restriction enzymes, a pmiR RB Report™ reporter gene plasmid vector (Guangzhou RiboBio Co., Ltd.) were combined with synthesized WT-SIRT1 or MUT-SIRT1 to construct recombinant plasmids, SIRT1-WT or SIRT1-MUT. Neurons (5×10⁴ cells/well) were co-transfected with 50 ng SIRT1-WT or 50 ng SIRT1-MUT, 25 ng pRL-TK (expressing Renilla luciferase as the internal control; Promega Corporation), and 50 nM miR-217 mimic (5′-UACUGCAUCAGGAACUGAUUGGA-3′) or 50 nM mimic control (5′-UUUGUACUACACAAAAGUACUG-3′) using Lipofectamine 2000 according to the manufacturer's protocols. At 24 h following transfection, luciferase activity was determined using a dual-luciferase assay system (Promega Corporation) and normalized to the Renilla luciferase activity.

Experiments in the present study were performed three times. Experimental analysis was conducted using SPSS 17.0 software (SPSS, Inc.). Data were presented as the mean ± standard deviation. Differences between groups were determined using Student's t-test or one-way ANOVA with a Bonferroni post hoc test. P<0.05 was considered to indicate a statistically significant difference.

To investigate whether miR-217 was involved in CIR injury in vitro, the levels of miR-217 in neurons following OGD/R or control treatment was determined via RT-qPCR analysis. As presented in Fig. 1, compared with the control, OGD/R treatment significantly upregulated the expression of miR-217 in neurons.

TargetScan was used to predict the potential targets of miR-217, and a putative binding site between SIRT1 and miR-217 was identified (Fig. 2A). To demonstrate the association between miR-217 and SIRT1, a luciferase reporter assay was conducted. miR-217 mimic was used to significantly upregulated miR-217 expression in neurons (Fig. 2B). As presented in Fig. 2C, compared with cells co-transfected with WT-SIRT1 and mimic control, luciferase activity was significantly decreased in neurons co-transfected with WT-SIRT1 and miR-217 mimic. The results indicated that miR-217 directly targeted SIRT1.

Subsequently, the protein and mRNA levels of SIRT1 in neurons following control or OGD/R treatment were determined via western blot and RT-qPCR analyses, respectively. As presented in Fig. 2D, OGD/R treatment markedly reduced SIRT1 protein expression in neurons. Additionally, compared with the control group, the mRNA levels of SIRT1 in neurons were significantly downregulated following OGD/R treatment (Fig. 2E).

To investigate the role of miR-217 in OGD/R-induced neuronal injury, neurons were transfected with miR-217 inhibitor, inhibitor control, control-siRNA, SIRT1-siRNA or miR-217 inhibitor + SIRT1-siRNA for 24 h, then subjected to OGD/R induction. The transfection efficiency was measured by RT-qPCR and/or western blotting. As presented in Fig. 3A, compared with the transfection control group, miR-217 inhibitor significantly downregulated the expression of miR-217 in neurons, whereas the mRNA levels of SIRT1 in neurons were decreased following SIRT1-siRNA transfection (Fig. 3B). The protein levels of SIRT1 in neurons were also reduced following SIRT1-siRNA transfection (Fig. 3D). Furthermore, it was demonstrated that miR-217 inhibitor significantly increased the mRNA expression of SIRT1 in neurons, and that this upregulation was attenuated by SIRT1-siRNA (Fig. 3C). miR-217 inhibitor also enhanced the protein expression of SIRT1 in neurons, in a manner that was attenuated by SIRT1-siRNA (Fig. 3E).

Then, the effects of miR-217 inhibitor on OGD/R-induced injury were determined via CCK-8 and LDH assays. Consistent with a previous study (25), OGD/R treatment significantly reduced cell viability and increased LDH release. The effects of OGD/R treatment were inhibited by miR-217 downregulation, and this inhibition was attenuated by SIRT1-siRNA (Fig. 4A and B). Additionally, miR-217 inhibition suppressed the OGD/R treatment-induced apoptosis of neurons (Fig. 4C and D). Collectively, the data indicated that miR-217 downregulation attenuated OGD/R-induced neuronal injury.

To further investigate the biological function of miR-217 in the regulation of OGD/R injury, the effects of miR-217 inhibitor on OGD/R-induced inflammation were determined. The levels of TNF-α, IL-6 and IL-1β were detected by ELISA. As presented in Fig. 5, the increased levels of TNF-α, IL-6 and IL-1β following OGD/R were significantly reduced by miR-217 inhibitor; however, these reductions were prevented by SIRT1-siRNA.

It was then investigated as to whether transfection with miR-217 inhibitor induced an effect on OGD/R-induced oxidative stress; it was observed that compared with the control, OGD/R treatment significantly enhanced the levels of ROS and MDA, and reduced those of SOD in neurons. Downregulation of miR-217 significantly decreased ROS production (Fig. 6A), reduced the levels of MDA (Fig. 6B) and increased those of SOD (Fig. 6C) in OGD/R-treated neurons, whereas these alterations were attenuated by SIRT1 silencing. The results indicated that miR-217 downregulation attenuated OGD/R-induced oxidative stress.

Finally, the SIRT1/AMPK-α/NF-κB pathway in OGD/R-treated neurons was analyzed to investigate the molecular mechanisms underlying the effects of miR-217 on OGD/R-induced neuronal injury. As presented in Fig. 7, compared with the control, OGD/R treatment significantly reduced SIRT1 mRNA and protein levels (Fig. 7A and B), decreased AMPK-α protein phosphorylation levels (Fig. 7A and C) and promoted p65 phosphorylation (Fig. 7A and D) in neurons. Compared with the OGD/R treatment group, miR-217 downregulation significantly upregulated SIRT1 and p-AMPK-α expression, and decreased p-p65 levels; these effects were eliminated by SIRT1 downregulation.