A total of 30 placentas were obtained from patients with PE and healthy controls who underwent cesarean section from January 2013 to September 2017. The age range of the patients was 23–39 years (mean age, 28.63±2.24 years). The diagnosis of PE was conducted as previously reported (21). The clinical data of patients was present in Table I. Patients with PE were characterized by high blood pressure and a high protein content in the urine. Tissues were quickly snap-frozen in liquid nitrogen during surgery and stored at −80°C until use. Written informed consent was obtained from each patient. The exclusion criteria for the two groups included: Patients with essential hypertension or kidney disease, a history of drug or alcohol abuse half year prior to providing written informed consent. In addition, the patients with PE were pathologically analyzed by two specialists.

HTR8/SVneo cells were acquired from the American Type Culture Collection (ATCC). Cells were cultured in RPMI-1640 (Labdel Comércio de Produtos para Laboratório) and 10% fetal bovine serum (Labdel Comércio de Produtos para Laboratório) and 100 streptomycin mg/ml, 100 penicillin U/ml, in a humidified chamber at 37°C with 5% CO₂.

The cell line was transfected with miR-342-3p mimics and the negative control (Thermo Fisher Scientific, Inc., cat. no. 4464058.) at a concentration of 100 nmol/l. The cells were transfected using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The duration between transfection and subsequent analysis was 48 h. The sequence of the miR-342-3p mimics was 5′-GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA-3′.

Small interfering RNAs (siRs) against PDGFRA (siRPDGFRA) and the control (scramble) were purchased from Santa Cruz Biotechnology, Inc. HTR8/SVneo cells were transfected with 20 µM siRPDGFRA or scramble siRNA utilizing Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols.

Total RNA was extracted from tissues and cells utilizing TRIzol reagent (Thermo Fisher Scientific, Inc.). For detecting mRNAs, a PrimeScript™ RT reagent kit (Takara Bio, Inc., cat. no. RR047A) was used for RT; the experiment was performed as follows: Three times at 37°C, 15 min for each time; and inactivation at 85°C for 5 sec. RT was performed for miRNAs using an Mir-X™ miRNA First-Strand Synthesis kit (Takara Bio, Inc, cat. no. 638313) according to the manufacturer's protocols. qPCR was performed using an SYBR^® qRT-PCR kit (Clontech Laboratories, Inc.) for mRNAs and miRNAs under the following thermocycling conditions: 94°C for 4 min, followed by 40 cycles of 94°C for 30 sec and 60°C for 60 sec. The sequences of primers employed were presented in Table II. Relative miRNA expression levels were standardized to that of small nucleolar RNA U6, whereas that for relative mRNA expression was normalized to the expression levels of β-actin using the 2^−ΔΔCq method (22).

Cells were collected 48 h after transfection and prepared for lysis in radioimmunoprecipitation assay buffer (BioVision, Inc.). Protein concentration was determined via a bicinchoninic acid assay. Protein (50 µg/lane) was separated via 8% SDS-PAGE. Separated proteins were transferred to polyvinylidene fluoride membranes (EMD Millipore). The membranes were blocked with 5% fat-free milk powder for 2 h at room temperature, and then incubated with primary antibodies against PDGFRA (1:1,000; Santa Cruz Biotechnology, Inc., cat. no. sc-338), anti-BCL-2 (1:1,000; Abcam, cat. no. ab59348), anti-Caspase-3 (1:500; Abcam, cat. no. ab13847) and β-actin antibody (1:1,000; Santa Cruz Biotechnology, Inc., cat. no. sc-47778) at 4°C overnight. Subsequently, the membranes were incubated with horseradish peroxidase-conjugated antimouse IgG (H+L) (1:10,000; Invitrogen; Thermo Fisher Scientific, Inc., cat. no. 62-6520) or anti-rabbit IgG (1:5,000; Invitrogen; Thermo Fisher Scientific, Inc., cat. no. 65-6122) antibody for 1 h at room temperature. The membranes were developed utilizing an ECL kit (Pierce; Thermo Fisher Scientific, Inc.) and visualized with X-ray film. Protein expression levels were standardized to those of β-actin. Data was analyzed by Quantity One version 4.62 software (Bio-Rad Laboratories, Inc.).

To analyze cell proliferation, a Cell Counting Kit-8 (CCK-8) assay was conducted using a CCK-8 proliferation assay kit (Dojindo Molecular Technologies, Inc.) at 0, 12, 24 and 48 h following transfection, according to the manufacturer's protocols. Cells were transfected with mimics or negative control (ctrl group), or treated with Lipofectamine 2000 without miRNA molecules in the mock group. Cells (1×10⁵) were seeded in 96-well plates for analysis. Then, 100 µl CCK-8 reagent was added to the well; at 2 h later, the absorbance was measured at 450 nm with a microplate reader.

Cell invasion was investigated based on the capacity of the cells invade through the 8 mm pores of polycarbonate membranes. Briefly, HTR8/SVneo cells (1.0×10⁵ cells/well) transfected with siRPDGFRA or scramble were placed in the upper chamber, and 600 µl of RPMI1640 medium with 10% fetal bovine serum was placed in the lower chamber. After incubating for 1 day under standard conditions at 37°C, the cells on the upper surface that had not migrated were removed with a sterile cotton swab. Migrated cells were stained with 0.1% crystal violet for 5 min at room temperature and analyzed under a light microscope in 5 random fields (magnification, ×200). The techniques used in the Transwell invasion assay were based on the cell migration assay; however, Matrigel was used.

The cell cycle was analyzed via flow cytometry. After 48 h post-transfection, HTR8/SVneo cells were trypsinized in chilled PBS, fixed in 70% ethanol for 24 h at −20°C, and then stained with propidium iodide for 10 min on ice. The samples were calculated using a flow cytometer and CellQuest Pro version 5.1 software (BD Biosciences).

TargetScan (version 6.0; http://www.targetscan.org/vert_60/), microcosm (version 1.1; http://tools4mirs.org/software/mirna_databases/microcosm-targets/) and miRanda (version August 2010; http://www.microrna.org/microrna/home.do) were used to predict miRNAs that could potentially target PDGFRA and identify possible binding regions. The fragment of the human PDGFRA with [wild type (wt)] or without [mutant (mut)] the miR-342-3p binding site at the 3′-untranslated region (3′-UTR) was cloned and inserted into the pGL3-basic luciferase report plasmid (Promega Corporation) to generate the luciferase reporter vectors, PDGFRA 3′-UTR-wt and PDGFRA 3′-UTR-mut. 293T cells (American Type Culture Collection) were treated in 96-well plates at 5,000 cells per well and incubated for 24 h at 37°C with 5% CO₂ prior to transfection. Then, miR-342-3p mimics or miR-negative control was transfected into 293T cells using Lipofectamine 2000 with 100 ng of PDGFRA 3′-UTR-wt or PDGFRA 3′-UTR-mut, or 10 ng of pRL-TK Renilla plasmid (Promega Corporation). Following incubation for 48 h, the luciferase activities were determined with a Dual Luciferase Reporter System (Promega Corporation); Renilla luciferase was used for normalization.

SPSS 19.0 (IBM Corp.) was employed for statistical analysis. Data were presented as the mean ± standard deviation, and an independent samples t-test was conducted for comparisons between two groups; analysis was performed in a two-tailed manner. Cell viability was analyzed by one-way analysis of variance with a Student-Newman-Keuls post hoc test. P<0.05 was considered to indicate a statistically significant manner.

The clinical information of patients was presented in Table I. Compared with the control group, patients with PE exhibited significantly higher systolic pressure and diastolic pressure, notable proteinuria and a significantly shorter duration of gestation (P<0.0001).

The expression of miR-342-3p and PDGFRA was analyzed in tissues via RT-qPCR. As presented in Fig. 1, miR-342-3p was significantly upregulated in the PE group compared with the control group (P<0.01; Fig. 1A). On the contrary, the expression of PDGFRA was significantly decreased in patients with PE compared with the control (P<0.01; Fig. 1B and C).

Additionally, to explore the role of miR-342-3p, we performed a CCK-8 assay to determine the effects of miR-342-3p on cell proliferation. After 48 h, we confirmed that transfection of miR-342-3p mimics into cells significantly increased miR-342-3p expression compared with the control group (P<0.01; Fig. 2A). Furthermore, RT-qPCR and western blotting were conducted to investigate the effects of miR-342-3p on PDGFRA in a cell line. Overexpression of miR-342-3p resulted in a significant decrease in the expression of PDGFRA at the mRNA (P=0.001; Fig. 2B) and protein levels (P=0.006; Fig. 2D) compared with the control. Cell proliferation was significantly inhibited (P=0.006; Fig. 2E) after transfection with miR-342-3p mimics compared with the control. In addition, the effects of miR-342-3p on the cell cycle of HTR-8/SVneo cells were analyzed via flow cytometry. The results demonstrated that the percentage of HTR-8/SVneo cells in G1 phase significantly increased from 59.66±3.75% prior transfection to 66.94±2.39% at 48 h post-transfection (P=0.047; Fig. 3A). The percentage of cells in S phase was significantly reduced from 24.79±1.87% prior transfection to 21.07±1.36% following transfection (P=0.049; Fig. 3A).

Additionally, Transwell migration and invasion assays were conducted. As presented in Fig. 4, transfection with miR-342-3p mimics significantly inhibited cell migration (P=0.027; Fig. 4A) and invasion (P=0.022; Fig. 4B) compared with the control group.

Transfection with miR-342-3p mimics significantly reduced the mRNA (P=0.017; Fig. 5A) and protein expression (P=0.035; Fig. 5C and E) levels of BCL-2. On the contrary, overexpression of miR-342-3p significantly increased the mRNA (P=0.001; Fig. 5B) and protein expression (P=0.001; Fig. 5D and E) levels of Caspase-3.

PDGFRA knockdown was performed in cells to its effects in PDGFRA in HTR-8/SVneo cells. After 48 h post-transfection, the mRNA and protein expression levels of PDGFRA were significantly decreased by 43.7±3.2% (P=1.56×10⁻⁴; Fig. 2C) and 47.0±5.0% (P=3.08×10⁻⁴; Fig. 2F), respectively, compared with the control. Additionally, PDGFRA knockdown significantly increased the percentage of HTR-8/SVneo cells in G1 phase from 56.63±1.40% prior to knockdown to 66.30±4.07% at 48 h following siR-PDGFRA transfection (P=0.018; Fig. 3B) compared with the control. Furthermore, cell proliferation (P=0.023; Fig. 2G), migration (P=0.01; Fig. 4C) and invasion (P=0.003; Fig. 4D) were significantly inhibited following PDGFRA knockdown compared with the control.

As presented in Fig. 6A, bioinformatics analysis indicated that the 3′-UTR of PDGFRA has a target sequence for miR-342-3p. Transfection with miR-342-3p mimics significantly decreased the luciferase activity of cells possessing PDGFRA 3′-UTR-wt compared with the control (P<0.01), while transfection with miR-342-3p mimics had no significant effects on the luciferase activity of cells possessing PDGFRA 3′-UTR-mut (Fig. 6B). These findings indicated that PDGFRA is likely to be a target of miR-342-3p.