The diabetic animal model was generated as previously described (28). In total, 24 male Sprague-Dawley rats (age, 4–6 weeks; weight, 180–200 g) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). A single dose of streptozotocin (STZ; 65 mg/kg, citrate buffer) was injected into 12 rats. An equal volume of citrate buffer was used as the control treatment (n=12). When blood glucose levels were >250 mg/dl, the animals were defined as diabetic rats. After 2 days following treatment, the animals became hyperglycemic. All rats were sacrificed by cervical dislocation under ketamine administration. Thoracic aorta samples from non-diabetic and diabetic rats were collected and isolated; mRNA and protein were extracted for further analysis. All the procedures and experimental protocols were approved by the Institutional Animal Care and Use Committee of Qianfoshan Hospital of Shandong (Jinan, China).

The isolation of primary VSMCs from the thoracic aorta of non-diabetic and diabetic rats was performed according to a previous study (29). Morphological and immunohistochemical analyses of VSMCs were performed as previously described (29). The 293 cells were purchased from the Shanghai Institute of Chinese Academy of Sciences (Shanghai, China). VSMCs and 293 cells were maintained in DMEM (HyClone; Thermo Fisher Scientific, Inc.) with 10% FBS (HyClone; Thermo Fisher Scientific, Inc.), as well as penicillin (100 U/ml; Bio-sciences Ltd., Dublin, Ireland) and streptomycin (100 U/ml; Bio-sciences, Ltd.) at 37°C within 5% CO₂. Experiments were conducted on transduced and non-transduced VSMCs of passages 3–8. For HG treatment, VSMCs were cultured in normal media (5 mM glucose) for 24 h, and then incubated with HG (25 mM glucose) or 20 mM mannitol plus 5 mM glucose (normal glucose, NG) for 24 h at 37°C with 5% CO₂.

miR-132 precursor and the corresponding miR-control were designed and synthesized by Shanghai GeneChem Co., Ltd. (Shanghai, China), and were cloned into pCDH-CMV-MCS-EF1-coGFP (System Biosciences, LLC, Palo Alto, CA, USA). The gene encoding E2F transcription factor 5 (E2F5) lacking the 3′UTR was amplified from rat genomic DNA by PCR using the Phusion High-Fidelity PCR Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. PCR thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, 72°C for 1 min and 4°C for 1 min. The following primers were used: E2F5 forward, AGAATTCATGGCGGCGGCGGAGCCCA and reverse, ATGGATCCCTAATAATTTAGTATCTGAACATCAA. Then, the PCR product was cloned into pCDH-CMV-MCS-EF1-Puro (Addgene). The production and purification of lentivirus and cell infection (multiplicity of infection, 100) were performed as previously described (30,31). Empty lentiviral vector pCDH-CMV-MCS-EF1-Puro (vector) was used as the control for lenti-E2F5 transduction. VSMCs from non-diabetic rats were infected with lenti-E2F5 or vector. Small interfering (si)RNAs targeting two different sites (cat. nos. RSS350386 and RSS350386) of the rat E2F5 gene and the negative control (cat. no. 12935100; scramble) were purchased from Thermo Fisher Scientific Inc. Cells were transfected with E2F5 siRNAs (100 nM) or scramble (100 nM) using Lipofectamine^® 2000 (Thermo Fisher Scientific Inc.) according to the manufacturer's protocols. miR-132 inhibitor (cat. no. 4464084) and corresponding negative control (inhibitor-NC; cat. no. 4464076) as well as miR-132 mimic (cat. no. 4464066) and corresponding negative control (miR-NC; cat. no. 4464058) were obtained from Thermo Fisher Scientific Inc. miR-132 mimic (100 nM) and miR-NC (100 nM) were used to transfect diabetic VSMCs. Normal VSMCs were transfected with miR-132 inhibitor (100 nM) and inhibitor-NC (100 nM) using Lipofectamine 2000 (Thermo Fisher Scientific Inc.) according to the manufacturer's protocol. Cells were collected and used for analysis at 72 h after infection or transfection. All constructions were confirmed by plasmid DNA sequencing.

miR-132 mimic, miR-132 inhibitor and corresponding negative control (miR-NC and inhibitor-NC, respectively) were obtained from Shanghai GenePharma Co., Ltd. (Shanghai, China). The wild-type E2F5 3′UTR and mutant-type E2F5 3′UTR were cloned into the reporter plasmid pGL3 (Promega Corporation, Madison, WI, USA) downstream of the luciferase reporter gene according to as previously described (26). For the dual luciferase assay, 293 cells were seeded into a 24-well plate at a density of 2×10⁴ cells per well. Cells were co-transfected with 1 µg of wild-type or mutant luciferase vector and miR-132mimics (100 nM), miR-132 inhibitor (100 nM) or their NCs. After co-transfection for 48 h, luciferase activity was detected using the dual luciferase Reporter Assay System (Promega Corporation) according to the manufacturer's instructions. Firefly luciferase activity was normalized to Renilla luciferase activity.

A bromodeoxyuridine (BrdU) incorporation assay was employed to detect the proliferation of VSMCs (22). VSMCs were transfected with E2F5 siRNAs (100 nM) or scramble (100 nM) using Lipofectamine 2000 (Thermo Fisher Scientific Inc.) according to the manufacturer's protocols. miR-132 mimic was used to transfect diabetic VSMCs. Normal VSMCs were transfected with miR-132 inhibitor using Lipofectamine 2000 (Thermo Fisher Scientific Inc.) according to the manufacturer's protocols. Following transfection, stable infection or co-infection of miR-132, miR-NC, lenti-E2F5 and lenti-vector, cells were seeded into 96-well plates at 3×10³ cells/well. Cells were cultured with NG or HG media for 24 h, and were then starved in FBS-free DMEM containing the aforementioned concentrations of glucose (NG or HG) for 24 h at 37°C with 5% CO₂. Subsequently, BrdU (10 µmol/l) was added into each well and incubated at 37°C for 30 min. The cells were fixed in 4% paraformaldehyde for 15 min at room temperature, and then detected using the cell proliferation ELISA kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. Absorbance values were detected at a wavelength of 450 nm using a microplate reader (Thermo Fisher Scientific, Inc.).

VSMC migration was detected by Transwell migration assay (22). VSMCs from non-diabetic rats were infected with lenti-E2F5 or vector. Following transfection, stable infection or co-infection of miR-132, miR-control, lenti-E2F5 and lenti-vector, cells were treated with NG or HG media for 48 h. Cells (5×10⁴) were plated into the upper chamber with 8-mm pore size (BD Bioscience, Franklin Lakes, NJ, USA), while 800 µl DMEM containing 1% FBS was placed in the lower chamber. After incubation for 6 h at 37°C, the cells in the upper membrane were removed with cotton swabs, and cells on the lower membrane were fixed in 4% paraformaldehyde for 15 min at room temperature and stained with crystal violet (1%) for 1 h at room temperature (Beyotime Institute of Biotechnology, Haimen, China). Cells were analyzed in 10 random fields per well (magnification, ×100) using a phase contrast light microscope.

Thoracic aorta tissue or VSMC was lysed with radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology) containing protease inhibitors (Roche Diagnostics) according to the manufacturer's instructions. The protein concentrations were measured with a BCA Protein Assay kit (Applygen Technologies, Inc., Beijing, China) according to the manufacturer's protocols. Protein samples (20 µg for each sample) were fractionated by SDS-PAGE on 10% gels, and then transferred to a polyvinylidene fluoride membrane (EMD Millipore, Bedford, MA, USA). The PVDF membranes were incubated with anti-E2F5 antibody (1:1,500; cat. no. ab176017; Abcam, Cambridge, UK) or anti-β-actin antibody (1:6,000; cat. no. ab8226; Abcam) at 4°C overnight. Then, the membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibodies (1:4,000; cat. no. ab205718; Abcam) for 1 h at room temperature. Finally, the protein bands were detected using an enhanced chemiluminescence detection kit (Pierce; Thermo Fisher Scientific, Inc.) and a ChemoDoc XRS detection system (Bio-Rad Laboratories, Inc.). The results were analyzed with ImageJ software (version 1.34e; National Institutes of Health, Bethesda, MD, USA).

Total RNA from thoracic aorta tissue or VSMCs was isolated using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. miRNAs were reversely transcribed into cDNA using the miScript Reverse Transcription Kit (Qiagen GmbH; cat. no. 218060) according to the manufacturer's protocol. For mRNA detection, cDNA was generated using the PrimeScript RT reagent kit (Takara Bio, Inc.) according to the manufacturer's protocol. miR-132 and E2F5 expression levels were quantified using the SYBR Green PCR Master Mix kit (Applied Biosystems; cat. no. 4309155). The sequences of the primers used are as follows: miR-132 forward, 5′-GGGTAACAGTCTACAGCCAT-3′ and miR-132 reverse, 5′-GGCAATTGCACTGGATAC-3′; U6 forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and U6 reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; rat E2F5 forward, 5′-GTACTTCCTTTGGCCTTAGTTT-3′ and reverse, 5′-CTGGCACCATCACACCGACATA-3′; rat β-actin forward, 5′-TGTCACCAACTGGGACGATATG-3′ and reverse, 5′-GGCTGGGGTGTTGAAGGTCTC-3′. The expression levels of miR-132 and E2F5 were quantified using the 2^−ΔΔCq method (32). RT-qPCR experiments were performed in triplicate.

The predicted target genes of miR-132 were identified using TargetScan (version 7.2; http://www.targetscan.org).

Data were expressed as the mean ± SD. One-way ANOVA followed by a Tukey's post-hoc test was conducted to assess significant differences. All statistical calculations were performed using SPSS 19.0 software (IBM Corp. Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

To investigate the potential roles of miR-132 and E2F5 in VSMCs under diabetic conditions, the expression of miR-132 and E2F5 in thoracic aorta samples and VSMCs non-diabetic and diabetic rats was detected by RT-qPCR and western blotting. Compared with the non-diabetic control rats, the expression levels of miR-132 in thoracic aorta samples and VSMCs of diabetic rats were significantly decreased compared with the control (P<0.001; Fig. 1A and C). Conversely, the mRNA and protein expression levels of E2F5 in thoracic aorta samples and VSMCs of diabetic rats were upregulated than in non-diabetic control rats (P<0.001; Fig. 1A-D). Taken together, our results revealed the opposing expression profiles of miR-132 and E2F5, which suggested their conflicting roles in the abnormal behavior of VSMCs mediated by diabetic conditions.

We investigated whether HG stimulation altered expression of miR-132 and E2F5. The results revealed that miR-132 was significantly downregulated (P<0.001), while the mRNA and protein expression levels of E2F5 were increased (P<0.001) in VSMCs incubated with HG media for 24 h compared with the control (Fig. 2). These findings further suggested the opposing expression profiles of miR-132 and E2F5 in HG-treated VSMCs.

Generally, miRNAs regulate gene expression by targeting the 3′UTR of these genes. Using TargetScan (http://www.targetscan.org), it was predicted that miR-132 binds to the 3′UTR of E2F5. As presented in Fig. 3A, the paired sequences between miR-132 and E2F5 3′UTR, and the mutant were determined. This prediction was confirmed by a dual luciferase reporter assay. The relative luciferase activity of the reporter containing the wild-type 3′UTR was significantly decreased by miR-132 overexpression compared with the control, but increased following transfection with miR-132 inhibitor (P<0.001; Fig. 3B). However, the luciferase activity of the mutant reporter was markedly affected by miR-132 overexpression and knockdown (Fig. 3B). These results suggested that miR-132 could directly bind to the 3′UTRs of E2F5 which were mutated in this study. We also overexpressed miR-132 in VSCMs from diabetic rats. The expression levels of miR-132 and E2F5 were detected by RT-qPCR and western blotting, respectively. The results showed the successful transfection of cells with miR-132 mimics (Fig. 3C); the expression of E2F5 was significantly decreased by miR-132 overexpression in the VSCMs from diabetic rats compared with the control (Fig. 3D). Additionally, downregulation of miR-132 (Fig. 3E) significantly increased the expression of E2F5 in VSCMs compared with the control (Fig. 3F). Our findings suggested that E2F5 was a target of miR-132.

Excessive cell proliferation and migration of VSMCs are fundamental mechanisms underlying CVDs in diabetes (10). This prompted us to investigate the functions of miR-132 and E2F5 in the proliferation and migration of VSMCs from diabetic rats by the nuclear incorporation of BrdU (DNA synthesis) and Transwell migration assays. We reported that the proliferation and migration of VSMCs from diabetic rats were significantly increased than that of VSMCs of non-diabetic rats (P<0.001; Fig. 4A and B). Furthermore, miR-132 was overexpressed in VSMCs from diabetic rats (Fig. 3C and D), then the proliferation and migration of cells were analyzed. The results showed that diabetic rat-derived VSMCs transfected with miR-132 exhibited significantly reduced proliferation and migration compared with the control group (P<0.001; Fig. 4C and D). In addition, VSMCs from non-diabetic rats were infected with lenti-E2F5 or vector. The results demonstrated that the expression of E2F5 significantly increased 5.2-fold in the lenti-E2F5 infection group compared the control group (P<0.001; Fig. 4E). Overexpression of E2F5 significantly increased the proliferative and migration abilities of normal rat VSMCs compared with the control (P<0.001; Fig. 4F and G). Thus, these data suggested that miR-132 and E2F5 serve opposing roles in the proliferation and migration of VSMCs.

To further confirm the function of E2F5 in VSMCs from diabetic rats, E2F5 expression was knocked down by delivery of E2F5 siRNAs, and the proliferation and migration of these VSMCs were analyzed. As determined by western blot analysis, the expression of E2F5 was significantly knocked down compared with the control (Fig. 5A). Of note, downregulation of E2F5 significantly inhibited the proliferation of diabetic rat VSMCs compared with those transfected with scramble siRNA (Fig. 5B). Additionally, compared with the control, downregulation of E2F5 significantly suppressed migration of diabetic VSMCs (Fig. 5C). Taken together, these results suggested that downregulation of E2F5 inhibited VSMC proliferation and migration similar to miR-132 overexpression.

We further examined whether E2F5 was involved in the inhibitory effects of miR-132 on the HG-induced proliferation and migration of VSMCs, overexpression of E2F5 was conducted by infecting miR-132 overexpressed VSMCs; cell proliferation and migration were detected by the nuclear incorporation of BrdU and a Transwell migration assay, respectively. The results showed that miR-132 was successfully overexpressed under HG conditions compared with the corresponding control (Fig. 6A). In addition, miR-132 inhibited HG-induced upregulation of E2F5 in VSMCs (Fig. 6B). Furthermore, transduction with lenti-E2F5 exhibited non-significant effect on the expression of miR-132, but could rescue downregulated E2F5 expression induced by miR-132 (Fig. 6A and B). Furthermore, our results showed that E2F5 overexpression could significantly rescue the inhibitory effects of miR-132 on the proliferation and migration of VSMCs, compared with VSMCs that were co-infected with miR-132 and vector (P<0.001; Fig. 6C-E). Thus, our findings suggested that miR-132 suppressed the proliferation and migration of HG-treated VSMCs by targeting E2F5.