Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2019.10457 mmr-20-03-2450 Articles Ascorbic acid attenuates cell stress by activating the fibroblast growth factor 21/fibroblast growth factor receptor 2/adiponectin pathway in HepG2 cells GuXinqian 1 2 LuoXiao 3 WangYanxin 1 2 HeZhangya 1 2 LiXiaomin 1 4 WuKunjin 1 ZhangYifan 1 YangYafeng 4 JiJing 5 LuoXiaoqin 1 2 Department of Nutrition and Food Safety, School of Public Health, Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China Nutrition and Food Safety Engineering Research Center of Shaanxi Province, Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China Department of Clinical Nutrition, Xian Yang Central Hospital, Xianyang, Shaanxi 712000, P.R. China Department of Obstetrics, Northwest Women and Children Hospital, Xi'an, Shaanxi 710061, P.R. China Correspondence to: Dr Xiaoqin Luo, Department of Nutrition and Food Safety, School of Public Health, Xi'an Jiaotong University, 76 Yanta West Road, Xi'an, Shaanxi 710061, P.R. China, E-mail: luoxiaoqin2012@mail.xjtu.edu.cn 092019 02072019 20 3 2450 2458 17122018 29052019 Copyright © 2019, Spandidos Publications 2019

Increasing prevalence of obesity-induced non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH) has been reported. Ascorbic acid (AA), also known as vitamin C, an excellent antioxidant, has been shown to exert beneficial effects on NAFLD; however, the underlying mechanisms are yet to be fully elucidated. In the present study, the role of AA on cell stress in tumor necrosis factor α (TNFα)-treated HepG2 cells was investigated. Our findings revealed that exposure to AA effectively ameliorated TNFα-induced cell stresses, including hypoxia, inflammation and endoplasmic reticulum (ER) stress by reducing the expression of Hif1α and its target genes (glucose transporter 1), pro-inflammatory genes (monocyte chemoattractant 1) and ER stress-related genes (glucose-regulated protein, 78 kDa). AA also decreased the protein level of HIF1α. Additionally, AA significantly increased the secretion of total adiponectin and high molecular weight (HMW) adiponectin. Mechanistically, AA was determined to increase the expression of fibroblast growth factor 21 (FGF21) and its receptor, fibroblast growth factor receptor 2 (FGFR2). Knockdown of FGFR2 not only decreased the levels of total adiponectin and HMW adiponectin, but almost abolished the beneficial effects of AA in ameliorating cell stress. Collectively, the findings of our study demonstrated that AA may attenuate hepatocyte stress induced by TNFα via activation of the FGF21/FGFR2/adiponectin pathway. This could a novel mechanism of action of AA, and its potential for the treatment of NAFLD/NASH.

 NAFLD/NASH ascorbic acid cell stress fibroblast growth factor 21 fibroblast growth factor receptor 2 adiponectin Introduction

Obesity, a common public health concern worldwide, is associated with the development of chronic metabolic diseases, including non-alcoholic fatty liver disease (NAFLD), which is characterized by the excessive accumulation of triglycerides (TAG) in the liver without inflammation (1). Studies have reported that NAFLD in patients may progress to non-alcoholic steatohepatitis (NASH), liver sclerosis and even hepatocellular carcinoma (2,3). Of these patients, obese individuals are more likely to suffer from NAFLD/NASH as increases in body weight have been shown to be positively associated with the accumulation of fat content in the liver (4). Amelioration of cellular stress in NAFLD/NASH models revealed an improvement in the levels of biomarkers related to cellular stress, such as markers of hypoxia, inflammation and endoplasmic reticulum (ER) stress, has been reported (5).

Adiponectin has been demonstrated to exert marked insulin-sensitizing and anti-inflammatory effects (6). Reduced circulating adiponectin levels (hypoadiponectinemia) have been linked to the etiology of obesity and obesity-related diseases (7). Adiponectin can be used to combat various types of liver damage, including liver disease induced by carbon tetrachloride, fructose, a high-fat diet, high cholesterol levels and ethanol (8–11). More importantly, a previous study demonstrated that a decrease in adiponectin levels is an independent risk factor of developing NAFLD (12). In recent years, researchers have found that high molecular weight (HMW) adiponectin is the predominant active form of adiponectin in the liver, and is closely associated with obesity and obesity-associated disorders (13–15). Fibroblast growth factor 21 (FGF21), a member of the FGF family, is secreted mainly from tissues with high metabolic activity, such as the liver and adipose tissue (16). FGF21 treatment has been reported to attenuate or eliminate the progression to NASH in animals (17). Furthermore, FGF21 knockdown has been shown to be associated with markedly more severe hepatic steatosis and inflammation, which can progress to severe NASH in mouse models of NAFLD (18,19). Increasing evidence suggests that FGF21 may be developed as a novel agent candidate for the treatment of NAFLD/NASH (20,21). Studies have shown that, partially dependent on peroxisome proliferator-activated receptor-γ activity, FGF21 can stimulate the transcription and secretion of adiponectin in adipocytes (22,23). The activation of the FGF21/adiponectin pathway has been reported to inhibit liver TAG accumulation, thereby reversing hepatic steatosis and improving NAFLD/NASH (23,24).

Ascorbic acid (AA), also known as vitamin C, is mainly found in a number of vegetables and fruits. As an excellent antioxidant, AA has a wide range of benefits, namely health-promoting and disease-preventing, and therapeutic properties (25). Studies have shown that AA, along with other antioxidants, such as vitamin E, can effectively inhibit oxidative stress, thereby reversing NAFLD (26,27). Apart from its antioxidative activity, AA can protect cells from stress via non-antioxidative pathways (28,29); however, these potential effects of AA alone on NAFLD/NASH and its mechanisms of action have not yet been well characterized. Additionally, AA has been reported to promote the secretion of HMW adiponectin from human adipocytes (30). To the best of our knowledge, whether AA can increase the expression of HMW adiponectin in hepatocytes remains unknown.

In spite of accumulating evidence, which typically describes the beneficial effects of AA on NAFLD/NASH in vivo or in vitro, further investigation is required to identify the specific roles of AA in obesity-associated factors-induced cell stress in hepatocytes. Thus, the aim of the present study was to determine the effects of AA on obesity-associated cell stress induced by tumor necrosis factor α (TNFα) in HepG2 cells and further explore the possible underlying mechanisms.

 Materials and methods <sec> <title>Materials

TNFα (cat. no. T6674) and AA (cat. no. A4403) were purchased from Sigma-Aldrich (Merck KGaA). Antibodies against FGF21 (cat. no. ab171941), hypoxia inducible factor 1α (HIF1α; cat. no. ab2185) and fibroblast growth factor receptor 2 (FGFR2; cat. no. ab109372) were obtained from Abcam; phosphorylated 5′AMP-activated protein kinase (p-AMPK; cat. no. 2531) and AMPK (cat. no. 2532) antibodies were from Cell Signaling Technology, Inc.; β-actin (cat. no. sc-47778), the horseradish peroxidase-conjugated secondary antibody goat-anti-rabbit (cat. no. sc-2004) and goat-anti-mouse (cat. no. sc-2005) IgG antibodies were obtained from Santa Cruz Biotechnology, Inc. All other reagents were from Sigma-Aldrich (Merck KGaA) unless otherwise stated.

 Cells and cell culture

HepG2 cells, a human hepatoma-derived cell line, were obtained from the American Type Culture Collection (HB-8065) and cultured routinely in a humidified atmosphere containing 5% CO2 at 37°C with Dulbecco's Modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), penicillin (100 IU/ml) and streptomycin (30 mg/ml). Cells were seeded into plates 24 h prior to the treatments at ~80% confluence. Cells were co-cultured with or without AA (0, 100, 200, 500, and 1,000 µM) and 10 ng/ml TNFα for 24 h in a humidified atmosphere containing 5% CO2 at 37°C. According to the findings from this experiment, 100 µM AA selected for further experimentation as this concentration effectively inhibited increases in the expression of cell stress-related genes induced by TNFα (data not shown). The cell groups were as follows: Control group, cultured in DMEM; TNFα group, treated with TNFα (10 ng/ml); and TNFα + AA group, cells co-cultured with TNFα (10 ng/ml) and AA (100 µM). For each assay, at least three independent experiments were conducted.

 Reverse transcription-quantitative PCR (RT-qPCR)

All primers were designed using Primer Express 3.0 software (Applied Biosystems; Thermo Fisher Scientific, Inc.; Table I). RT reactions were conducted using an RT kit (cat. no. RR036A; Takara Bio, Inc.) and SYBR®-Green PCR Super mix (cat. no. A25741; Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The conditions of PCR used Applied Biosystems ViiA™ 7 Dx qPCR System in this study were as follows: Initial denaturation: 95°C, 5 min; 40 cycles of denaturation (95°C, 30 sec), annealing (58°C, 30 sec), and elongation (72°C, 60 sec). The fluorescent signals were detected during the extension phase, Quantification cycle (Cq) values of the sample were calculated. The expression of Gapdh was assessed as a housekeeping gene. The relative expression of the gene of interest was analyzed using the 2−ΔΔCq method (31). All the experiments were repeated three times.

 Western blot analysis

Cells were harvested and homogenized in lysis buffer (Pierce; Thermo Fisher Scientific, Inc.) at 4°C. The homogenates were centrifuged at 12,000 × g at 4°C for 15 min. Protein was quantified using a Bio-Rad Protein Assay kit (Bio-Rad Laboratories, Inc.). Protein samples (20 µg) were separated on SDS-PAGE, transferred to PVDF membranes, and blocked with 5% of BSA in TBS-T buffer (10 mM Tris HCl, pH 7.5, 150 mM NaCl, 0.15% Tween-20) at room temperature for 90 min. Following washing with TBST, the membranes were incubated with primary antibodies at 4°C overnight, the primary antibodies were as follows: Anti-β-actin (1:1,000; cat. no. sc-47778; Santa Cruz Biotechnology Inc.); anti-HIF1α (1:200; cat. no. ab2185; Abcam); anti-FGFR2 (1:1,000; cat. no. ab109372; Abcam); anti-FGF21 (1:1,000; cat. no. ab171941; Abcam); anti-p-AMPK (1:1,000; cat. no. 2531; Cell Signaling Technology, Inc.), anti-AMPK (1:1,000; cat. no. 2532; Cell Signaling Technology, Inc.), followed by incubation with appropriate secondary antibodies for 1 h at room temperature, the primary antibodies were as follows: Goat anti-rabbit IgG antibodies (1:5,000; cat. no. sc-2004; Santa Cruz Biotechnology, Inc.) and goat anti-mouse IgG antibodies (1:5,000; cat. no. sc-2005; Santa Cruz Biotechnology, Inc.). Finally, they were detected using an enhanced chemiluminescence system (EMD Millipore). The band intensities were quantified by using ImageJ software version 1.8.0 (National Institutes of Health, Bethesda, MD, USA). The calculated ratio of the intensity of the target protein to that of β-actin corresponded to the expression level of the protein.

 ELISA

HepG2 cells were collected under aseptic conditions and incubated (5×106 cells/well) in 6-well culture plates at 37°C in humidified 5% CO2. Following treatment as aforementioned, the conditioned medium from the cells was collected for determining the secretion of total adiponectin (cat. no. ab99968, Abcam) and HMW adiponectin (cat. no. CSB-E07270h, CUSABIO) using ELISA kits. Cells were then washed twice with ice-cold PBS and lysed in lysis buffer comprising 50 mM Tris (pH 7.4), 150 mM NaCl, 10% (w/v) glycerol, 10 mM EDTA, 1 mM MgCl2, 20 mM b-glycerophosphosphate, 30 mM NaF, 1% Triton X-100, 25 mg/ml leupeptin, 25 mg/ml pepstatin and 3 mg/ml aprotinin. After incubation on ice for 20 min, cell lysates were centrifuged at 12,000 × g for 30 min at 4°C. A BCA Protein Assay was used to quantify the total protein of cells. The concentration of HIFα was measured using a commercially available ELISA kit (cat. no. ab171577, Abcam) according to the manufacturer's instructions.

 RNA interference

The small interfering RNA (siRNA) sequences targeting human Fgfr2 were designed using siRNA primer design software (Guangzhou RiboBio Co., Ltd.; Table II). We mixed the three individual targeting siRNAs (50 nM of each) at a ratio of 1:1:1 (Fgfr2 siRNA) for transfection. HepG2 cells were seeded on 6-well plates at 37°C for 24 h until 50–80% confluence was attained. Cells were subsequently transfected with 50 nM of the Fgfr2 siRNA mixture or scramble (Scr) control siRNA using riboFECT™ CP (Guangzhou RiboBio Co., Ltd.).

 Statistical analysis

All experiments were performed in triplicate. The results are presented as the mean ± standard error of mean. Significant differences were determined by one-way ANOVA followed by the Least Significant Difference test using SPSS 18.0 software (SPSS, Inc.). P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>AA reduces TNFα -induced cell stress in HepG2 cells

To establish a cellular model of obesity-related NAFLD, TNFα, an obesity-associated insult factor, was used to induce cell stress in HepG2 cells. As presented in Fig. 1, treatment with TNFα (10 ng/ml) for 24 h was determined to successfully promote cellular hypoxia, inflammation and ER stress, as determined by the significant increase in HIF1α expression compared with the control. Incubation with AA (100 µM) for 24 h significantly decreased the protein and mRNA expression levels of HIF1α in HepG2 cells compared with TNFα treatment alone (Fig. 1A-C). Additionally, AA treatment resulted in a significant decrease in the mRNA levels of glucose transporter 1 (Glut1), an important target gene of HIF1α (Fig. 1D) (32). In addition, AA reduced the mRNA levels of the inflammatory factor, monocyte chemoattractant 1 (Mcp1; Fig. 1E), and the ER stress factor, glucose-regulated protein, 78 kDa (Grp78; Fig. 1F). However, the mRNA expression levels of vascular endothelial growth factor A (Vegfa; Fig. 1D), interleukin (Il)−6 (Fig. 1E) and spliced X-box-binding protein 1 (Sxbp1; Fig. 1F) were markedly unaffected by TNFα and AA treatment for 24 h.

 AA activates the FGF21/FGFR2/adiponectin pathway

In addition, we examined the effects of AA treatment on adiponectin expression, and the secretion of total and HMW adiponectin. Compared with the control group, the secretion of HMW adiponectin, but not that of total adiponectin was inhibited by TNFα treatment. However, TNFα and AA co-treatment resulted in a significant increase in the secretion of total and HMW adiponectin compared with TNFα treatment alone (Fig. 2A and B). We also detected the expression of the upstream molecules involved in the signaling pathways of adiponectin. The addition of AA significantly increased the expression of FGFR2 and FGF21 than with TNFα alone; compared with the control, TNFα treatment notably induced the expression of FGF21 (Fig. 2C-E). Conversely, the expression levels of p-AMPK and AMPK were markedly unaffected in all treatment groups (Fig. 2D and E), suggesting that the AMPK signaling pathway may not have been activated by AA.

 Fgfr2 knockdown attenuates the effects of AA on total and HMW adiponectin

In order to confirm the role of FGF21/FGFR2 in beneficial effects of AA in this study, FGFR2 expression was silenced via RNA interference. Compared with Scr siRNA, the transfection of siRNA targeting Fgfr2 successfully inhibited the expression of FGFR2 (P<0.001; Fig. 3A and B). Compared with Scr siRNA, Fgfr2 knockdown significantly suppressed the increase in the secretion of both total adiponectin and HMW adiponectin induced by AA (Fig. 3C and D).

 Fgfr2 knockdown abolishes the effects of AA on cell stress

We finally assessed the effects of Fgfr2 knockdown on cellular stress in HepG2 cells. In the Scr siRNA-transfected group, AA treatment appeared to reverse the increase in all cell stress markers at the mRNA and protein levels due to TNFα, including HIF1α (Fig. 4A and B) and its target genes, Glut and Vegfa (Fig. 4C and D), and the gene expression of inflammatory-related factors (Mcp1 and Il-6; Fig. 4E and F) and ER stress-related factors (Grp78 and Sxbp1; Fig. 4G and H); significant differences were observed between the Scr-siRNA and Fgfr2-siRNA groups following co-treatment. Furthermore, the role of AA in improving NAFLD/NASH proposed in the present study is summarized as a schematic diagram in Fig. 4I. AA was suggested to suppress obesity-associated insult via the inhibition of TNFα-induced cellular hypoxia, inflammation and ER stress. These benefits of AA are likely to be mediated by the activation of the FGF21/FGFR2/adiponectin signaling pathway in hepatocytes.

 Discussion

Long-term exposure to obesity-associated insults induced by TNFα and saturated fatty acids causes lipid accumulation in the liver, which leads to fatty liver disease, known as NAFLD, which may progress to NASH (33). In the present study, TNFα-treated HepG2 cells were employed to examine the effects of AA on hepatocyte stress in obesity-related NAFLD in vitro. Our results revealed that AA: i) Significantly ameliorated TNFα-induced cell stresses, including hypoxia, inflammation and ER stress; ii) significantly promoted the secretion of HMW adiponectin from TNFα-treated cells; and iii) activated the FGF21/FGFR2/adiponectin signaling pathway to exert these beneficial effects as mentioned above.

Our data demonstrated that AA co-treatment effectively attenuated TNFα-induced cell stress. The expression of TNFα, a known pro-inflammatory factor, is significantly elevated in patients with NAFLD/NASH, and is involved in liver lipid metabolism and inflammation (33,34). Thus, TNFα-induced HepG2 cells were employed in the present study to establish an in vitro model in order to mimic the unhealthy state of hepatocytes in the obesity-related NAFLD/NASH population. Our results revealed that TNFα successfully induced hepatocyte stress in the form of increased hypoxia, inflammation and ER stress.

The human body cannot synthesize vitamin C; a lower consumption of vitamin C has been associated with a decreased plasma level of AA, which may increase the risk of developing metabolic diseases, including NAFLD/NASH (27). In addition, hepatocytes from patients with NAFLD/NASH suffer from various types of stress, such as hypoxia, inflammation and ER stress (35–37). Therefore, we aimed to investigate the effects of AA on NAFLD/NASH beyond its traditional characteristic as an excellent antioxidant. Our results reported that AA reversed the aforementioned stresses triggered by TNFα. Similar findings have also been reported in human intervention studies. For example, overweight adults supplemented with AA (1,000 mg/day) for 2 months exhibited significantly reduced plasma c-reactive protein levels (38). Of note, we reported AA to reduce the levels of HIF1α protein. Generally, the total level of HIF1α does not usually change under hypoxia (39); although the mechanism associated with the expression of HIF1α under these conditions was not explored in our study, further investigation is required. AA can inhibit the stability and transcriptional activity of HIF1α protein. As mentioned in a previous study (32), HIF-1 is downregulated by iron-containing 2-oxoglutarate-dependent enzymes that require AA as a cofactor; HIF-1-dependent gene expression is effectively suppressed by AA and is inhibited even under conditions that allow HIF-1α protein stabilization. Additionally, Vissers et al (40) have found that AA is the main regulator of the hypoxic response in normal cells, and the optimal level of AA has an important impact on HIF-1 regulation (41). Taken together, these results demonstrate that AA alone may be beneficial for the amelioration of obesity-induced NAFLD/NASH by attenuating a wide range of hepatocyte stresses.

This study also measured the secretion of total adiponectin and HMW adiponectin levels, as obesity-associated NAFLD/NASH has been associated with decreased levels of circulating adiponectin and HMW adiponectin (42). We found that TNFα reduced the secretion of HMW adiponectin, but exerted no notable effects on total adiponectin levels. Treatment with AA not only increased total adiponectin secretion, but also attenuated reductions in HMW adiponectin secretion induced by TNFα. Our results were consistent with those of a recent study, which indicated that the beneficial effects of AA are closely associated with improvements in adiponectin profiles rather than changes in total adiponectin levels (43). Therefore, the findings of the present study may suggest that AA may exert its beneficial effects on hepatocyte stress by increasing the levels of adiponectin levels, particularly HMW adiponectin.

Over the past few years, the specific roles of FGF21/FGFR2 in modulating obesity and obesity-associated metabolic diseases, such as NAFLD/NASH and type 2 diabetes have undergone extensive study (44–46). Although FGF21 expression has been shown to be notably elevated in obese individuals, long-term treatment with FGF21 was determined to favorably improve the outcomes linked to obesity and NAFLD (47,48). Adiponectin is a downstream effector of FGF21/FGFR2 (49,50). A recent study also suggested that the FGF21/adiponectin/IL-17A pathway is crucial in alleviating hepatic steatosis and inflammation in a mouse model of NASH (24). Nevertheless, to the best of our knowledge, no studies have investigated the effects of AA on the FGF21/FGFR2 signaling pathway, although white pitaya juice, which contains AA, was proposed to attenuate hepatic steatosis in obese mice (51). The results of our study demonstrated that AA significantly increased the mRNA and protein expression levels of FGF21 and FGFR2, and adiponectin secretion. Furthermore, FGFR2 knockdown almost abolished the protective effects of AA in terms of blocking the reduction of HIF1α and the downregulation of cellular stress-related genes. Unexpectedly, TNFα also induced FGF21 expression; further investigations are warranted to determine the mechanisms underlying this effect. An overlap in energy metabolism has been reported between the AMPK and FGF21 signaling pathways (52–54). However, in our specific model, AA did not activate the AMPK pathway; this was inconsistent with the findings of another study which reported that strawberry extract attenuated lipid accumulation in HepG2 cells via AMPK activation (55). This inconsistency may be explained by the different agents used; strawberry extract contains other bioactive substances apart from AA that may activate the AMPK pathway. Collectively, these results illustrated that the FGF21/FGFR2/adiponectin signaling pathway could serve a crucial role in attenuating obesity-related insult-associated hepatocyte stress by AA.

In conclusion, the present study demonstrated that AA effectively attenuated hepatocyte stress induced by obesity-related insults through activation of the FGF21/FGFR2/adiponectin pathway, which may suggest a novel mechanism of AA in alleviating NAFLD/NASH. Further investigation is required to verify the role of AA in NAFLD/NASH in future studies.

Our study has certain limitations in that HepG2 cells were employed to establish an in vitro model of NAFLD. Under certain culture conditions, HepG2 cells display robust morphological and functional differentiation. Therefore, this cell line can be important for the study of human liver diseases, yet this cell line represent as a model of cancer rather than normal human liver. Thus, the results of the present study require further verification in vivo.

 Acknowledgements

Not applicable.

 Funding

This study was supported by the Fundamental Research Funds for the Central Universities (grant. no. xjj2017186); National Natural Science Foundation of China (grant. no. 81874263); and China Postdoctoral Science Foundation (grant. no. 2017T100759).

 Availability of data and materials

All data used and/or analyzed during the present study are available from the corresponding author on reasonable request.

 Authors' contributions

XQG, XL and XQL made substantial contributions to the design of this study. XQG, ZYH, KJW and YFZ performed the experiments. ZYH, YXW and XML conducted the RT-qPCR and western blot analysis experiments. YFY, JJ and XQG interpreted the results and wrote the draft of the manuscript. XQL and XL critically revised the manuscript for important intellectual content. All authors read and approved the final manuscript and agreed to the publication of the final manuscript.

 Ethics approval and consent to participate

Not applicable

 Patient consent for publication

Not applicable

 Competing interests

The authors declare that they have no competing interests.

 References YounossiZMKoenigABAbdelatifDFazelYHenryLWymerMGlobal epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomesHepatology647384201610.1002/hep.2843126707365 CasteraLVilgrainVAnguloPNoninvasive evaluation of NAFLDNat Rev Gastroenterol Hepatol10666675201310.1038/nrgastro.2013.17524061203 AhmedAWongRJHarrisonSANonalcoholic fatty liver disease review: Diagnosis, treatment, and outcomesClin Gastroenterol Hepatol1320622070201510.1016/j.cgh.2015.07.02926226097 FabbriniESullivanSKleinSObesity and nonalcoholic fatty liver disease: Biochemical, metabolic, and clinical implicationsHepatology51679689201010.1002/hep.23280200414063575093 HandaPVemulakondaALMalikenBDMorgan-StevensonVNelsonJEDhillonBKHennesseyKAGuptaRYehMMKowdleyKVDifferences in hepatic expression of iron, inflammation and stress-related genes in patients with nonalcoholic steatohepatitisAnn Hepatol167785201710.5604/16652681.1226818 TrujilloMESchererPEAdiponectin-journey from an adipocyte secretory protein to biomarker of the metabolic syndromeJ Intern Med257167175201010.1111/j.1365-2796.2004.01426.x KawanoJAroraRThe role of adiponectin in obesity, diabetes, and cardiovascular diseaseJ Cardiometab Syndr44449200910.1111/j.1559-4572.2008.00030.x19245516 HebbardLGeorgeJAnimal models of nonalcoholic fatty liver diseaseNat Rev Gastroenterol Hepatol83544201110.1038/nrgastro.2010.19121119613 MandalPParkPHMcMullenMRPrattBTNagyLEThe anti-inflammatory effects of adiponectin are mediated via a heme oxygenase-1-dependent pathway in rat Kupffer cellsHepatology5114201429201010.1002/hep.23427200527722908267 LeeUEFriedmanSLMechanisms of hepatic fibrogenesisBest Pract Res Clin Gastroenterol25195206201110.1016/j.bpg.2011.02.005214977383079877 PolyzosSAKountourasJZavosCTsiaousiERole of adiponectin in the pathogenesis and treatment of nonalcoholic fatty liver diseaseDiabetes Obes Metab12365383201010.1111/j.1463-1326.2009.01176.x20415685 FinelliCTarantinoGWhat is the role of adiponectin in obesity related non-alcoholic fatty liver disease?World J Gastroenterol19802812201310.3748/wjg.v19.i6.802234300393574877 PhillipsLKPeakeJMZhangXHickmanIJBriskeyDRHuangBESimpsonPLiSHWhiteheadJPMartinJHPrinsJBPostprandial total and HMW adiponectin following a high-fat meal in lean, obese and diabetic menEur J Clin Nutr67377384201310.1038/ejcn.2013.4923462948 LiuXTongWZhaoXZhangHTangYDengXChinese herb extract improves liver steatosis by promoting the expression of high molecular weight adiponectin in NAFLD ratsMol Med Rep1655805586201710.3892/mmr.2017.728428849192 ZhangXSunLRLiMZThe changes of serum high molecular weight adiponectin levels in T2DM with nonalcoholic fatty liver diseaseMedical Innovation of China9572013 GimenoREMollerDEFGF21-based pharmacotherapy-potential utility for metabolic disordersTrends Endocrinol Metab25303311201410.1016/j.tem.2014.03.00124709036 LeeJHKangYEChangJYParkKCKimHWKimJTKimHJYiHSShongMChungHKKimKSAn engineered FGF21 variant, LY2405319, can prevent non-alcoholic steatohepatitis by enhancing hepatic mitochondrial functionAm J Transl Res8475047632016279046775126319 FisherFMChuiPCNasserIAPopovYCunniffJCLundasenTKharitonenkovASchuppanDFlierJSMaratos-FlierEFibroblast growth factor 21 limits lipotoxicity by promoting hepatic fatty acid activation in mice on methionine and choline-deficient dietsGastroenterology14710731083.e6201410.1053/j.gastro.2014.07.044250836074570569 FisherFMMaratos-FlierEUnderstanding the physiology of FGF21Annu Rev Physiol78223241201610.1146/annurev-physiol-021115-10533926654352 InagakiTResearch perspectives on the regulation and physiological functions of FGF21 and its association with NAFLDFront Endocrinol (Lausanne)6147201510.3389/fendo.2015.00147264418374585294 MussoGCassaderMGambinoRNon-alcoholic steatohepatitis: Emerging molecular targets and therapeutic strategiesNat Rev Drug Discov15249274201610.1038/nrd.2015.326794269 VerniaSCavanagh-KyrosJGarcia-HaroLSabioGBarrettTJungDYKimJKXuJShulhaHPGarberMThe PPARα-FGF21 hormone axis contributes to metabolic regulation by the hepatic JNK signaling pathwayCell Metab20512525201410.1016/j.cmet.2014.06.010250438174156535 PiccininEMoschettaAHepatic-specific PPARα-FGF21 action in NAFLDGut6510751076201610.1136/gutjnl-2016-31140826992428 BaoLYinJGaoWWangQYaoWGaoXA long-acting FGF21 alleviates hepatic steatosis and inflammation in NASH mice partly through an FGF21- adiponectin- IL17A pathwayBr J Pharmacol17533793393201810.1111/bph.14383298590196057909 DuerbeckNBDowlingDDDuerbeckJMVitamin C: Promises not keptObstet Gynecol Surv71187193201610.1097/OGX.000000000000028926987583 OliveiraCPGayottoLCTataiCDella NinaBILimaESAbdallaDSLopassoFPLaurindoFRCarrilhoFJVitamin C and vitamin E in prevention of nonalcoholic fatty liver disease (NAFLD) in choline deficient diet fed ratsNutr J29200310.1186/1475-2891-2-914613504270010 Hadzi-PetrushevNDimovskaKJankulovskiNMitrovDMladenovMSupplementation with Alpha-Tocopherol and ascorbic acid to nonalcoholic fatty liver disease's statin therapy in menAdv Pharmacol Sci201846730612018298878855985129 FischerAPMilesSLAscorbic acid, but not dehydroascorbic acid increases intracellular vitamin C content to decrease Hypoxia Inducible Factor-1 alpha activity and reduce malignant potential in human melanomaBiomed Pharmacother86502513201710.1016/j.biopha.2016.12.05628012930 PiresASMarquesCREncarnaçãoJCAbrantesAMMamedeACLaranjoMGonçalvesACSarmento-RibeiroABBotelhoMFAscorbic acid and colon cancer: An oxidative stimulus to cell death depending on cell profileEur J Cell Biol95208218201610.1016/j.ejcb.2016.04.00127083410 RoseFJWebsterJBarryJBPhillipsLKRichardsAAWhiteheadJPSynergistic effects of ascorbic acid and thiazolidinedione on secretion of high molecular weight adiponectin from human adipocytesDiabetes Obes Metab1210841089201010.1111/j.1463-1326.2010.01297.x20977580 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 KuiperCDachsGUCurrieMJVissersMCIntracellular ascorbate enhances hypoxia-inducible factor (HIF)-hydroxylase activity and preferentially suppresses the HIF-1 transcriptional responseFree Radic Biol Med69308317201410.1016/j.freeradbiomed.2014.01.03324495550 KanuriGSprussAWagnerbergerSBischoffSCBergheimIRole of tumor necrosis factor α (TNFα) in the onset of fructose-induced nonalcoholic fatty liver disease in miceJ Nutr Biochem22527534201110.1016/j.jnutbio.2010.04.00720801629 AjmalMRYacchaMMalikMARabbaniMUAhmadIIsalmNAbdaliNPrevalence of nonalcoholic fatty liver disease (NAFLD) in patients of cardiovascular diseases and its association with hs-CRP and TNF-αIndian Heart J66574579201410.1016/j.ihj.2014.08.006256343874310973 MannJPRaponiMNobiliVClinical implications of understanding the association between oxidative stress and pediatric NAFLDExpert Rev Gastroenterol Hepatol11371382201710.1080/17474124.2017.129134028162008 MaheshKKumarPPAliMSEndoplasmic reticulum (ER) stress in non-alcoholic fatty liver disease (NAFLD)J Clin Exp Hepatol2S38S392012(In Chinese)10.1016/S0973-6883(12)60073-5 AoNYangJWangXDuJGlucagon-like peptide-1 preserves non-alcoholic fatty liver disease through inhibition of the endoplasmic reticulum stress-associated pathwayHepatol Res46343353201610.1111/hepr.1255126147696 BlockGJensenCDDalviTBNorkusEPHudesMCrawfordPBHollandNFungEBSchumacherLHarmatzPVitamin C treatment reduces elevated C-reactive proteinFree Radic Biol Med467077200910.1016/j.freeradbiomed.2008.09.03018952164 SchumackerPTHypoxia-inducible factor-1 (HIF-1)Crit Care Med33423425200510.1097/01.CCM.0000191716.38566.E0 VissersMCGunninghamSPMorrisonMJDachsGUCurrieMJModulation of hypoxia-inducible factor-1 alpha in cultured primary cells by intracellular ascorbateFree Radic Biol Med42765772200710.1016/j.freeradbiomed.2006.11.02317320759 MiyataTWadaYCaiZIidaYHorieKYasudaYMaedaKKurokawaKvan Ypersele de StrihouCImplication of an increased oxidative stress in the formation of advanced glycation end products in patients with end-stage renal failureKidney Int5111701181199710.1038/ki.1997.1609083283 LiGYinJFuJLiLGrantSFALiCLiMMiJLiMGaoSFGF21 deficiency is associated with childhood obesity, insulin resistance and hypoadiponectinaemia: The BCAMS studyDiabetes Metab43253260201710.1016/j.diabet.2016.12.00328139438 McMorrowAMConnaughtonRMMagalhãesTRMcGillicuddyFCHughesMFCheishviliDMorineMJEnnisSHealyMLRocheEFPersonalized cardio-metabolic responses to an anti-inflammatory nutrition intervention in obese adolescents: A randomized controlled crossover trialMol Nutr Food Res62e1701008201810.1002/mnfr.20170100829665620 XuJLloydDJHaleCStanislausSChenMSivitsGVonderfechtSHechtRLiYSLindbergRAFibroblast growth factor 21 reverses hepatic steatosis, increases energy expenditure, and improves insulin sensitivity in diet-induced obese miceDiabetes58250259200910.2337/db08-0392188407862606881 SinghalGKumarGChanSFisherFMMaYVardehHGNasserIAFlierJSMaratos-FlierEDeficiency of fibroblast growth factor 21 (FGF21) promotes hepatocellular carcinoma (HCC) in mice on a long term obesogenic dietMol Metab135666201810.1016/j.molmet.2018.03.002297536786026320 SammsRJLewisJENortonLStephensFBGaffneyCJButterfieldTSmithDPChengCCPerfieldJWIIAdamsACFGF21 is an insulin-dependent postprandial hormone in adult humansJ Clin Endocrinol Metab10238063813201710.1210/jc.2017-01257289384345630254 ZhangJLiYFibroblast growth factor 21, the endocrine FGF pathway and novel treatments for metabolic syndromeDrug Discovery Today19579589201410.1016/j.drudis.2013.10.02124189035 TalukdarSZhouYLiDRossulekMDongJSomayajiVWengYClarkRLanbaAOwenBMA long-acting FGF21 molecule, PF-05231023, decreases body weight and improves lipid profile in non-human primates and type 2 diabetic subjectsCell Metab23427440201610.1016/j.cmet.2016.02.00126959184 HollandWLAdamsACBrozinickJTBuiHHMiyauchiYKusminskiCMBauerSMWadeMSinghalEChengCCAn FGF21-adiponectin-ceramide axis controls energy expenditure and insulin action in miceCell Metab17790797201310.1016/j.cmet.2013.03.019236637423667496 LinZTianHLamKSLinSHooRCKonishiMItohNWangYBornsteinSRXuALiXAdiponectin mediates the metabolic effects of FGF21 on glucose homeostasis and insulin sensitivity in miceCell Metab17779789201310.1016/j.cmet.2013.04.00523663741 SongHZhengZWuJLaiJChuQZhengXWhite pitaya (Hylocereus undatus) juice attenuates insulin resistance and hepatic steatosis in diet-induced obese micePLoS One11e0149670201610.1371/journal.pone.0149670269140244767368 BerglundEDKangLLee-YoungRSHasenourCMLustigDGLynesSEDonahueEPSwiftLLCharronMJWassermanDHGlucagon and lipid interactions in the regulation of hepatic AMPK signaling and expression of PPARalpha and FGF21 transcripts in vivoAm J Physiol Endocrinol Metab299E607E614201010.1152/ajpendo.00263.2010206639882957865 LiuXWangYHouLXiongYZhaoSFibroblast growth factor 21 (FGF21) promotes formation of aerobic myofibers via the FGF21-SIRT1-AMPK-PGC1α pathwayJ Cell Physiol23218931906201710.1002/jcp.2573527966786 SalminenAKauppinenAKaarnirantaKFGF21 activates AMPK signaling: Impact on metabolic regulation and the aging processJ Mol Med (Berl)95123131201710.1007/s00109-016-1477-127678528 Forbes-HernándezTYGiampieriFGasparriniMAfrinSMazzoniLCorderoMDMezzettiBQuilesJLBattinoMLipid accumulation in HepG2 cells is attenuated by strawberry extract through AMPK activationNutrients9E621201710.3390/nu906062128621732

AA (100 µM) attenuates TNFα-induced (10 ng/ml) cell stress. (A and B) HIF1α expression in HepG2 cells was determined by western blotting and ELISA; (C) mRNA expression levels of mRNA levels in HepG2 cells were assessed cells by RT-qPCR, respectively. The mRNA expression levels of factors related to (D) hypoxia, (E) inflammation and (F) endoplasmic reticulum stress were assessed in HepG2 cells by RT-qPCR. Data are expressed as fold changes compared with the control group. All data are presented as the mean ± standard error of the mean. *P<0.05; **P<0.01. AA, ascorbic acid; Glut1, glucose transporter 1; Grp78, glucose-regulated protein, 78 kDa; HIF1α, hypoxia inducible factor 1α; IL-6, interleukin-6; Mcp1, monocyte chemoattractant 1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Sxbp1, spliced X-box-binding protein 1; TNFα, tumor necrosis factor α; Vegfa, vascular endothelial growth factor A.

AA activates the FGF21/FGFR2/adiponectin pathway in HepG2 cells. ELISA of (A) total adiponectin and (B) HMW adiponectin secretion in all groups. (C) Reverse transcription-quantitative polymerase chain reaction analysis of Fgf21 and Fgfr2 gene expression in HepG2 cells. (D) Representative images of FGFR2, FGF21, p-AMPK and AMPK protein levels from 3 independent experiments and (E) fold changes of protein levels relative to the control group are shown. Control group, cultured in DMEM medium; TNFα group, treated with TNFα (10 ng/ml); and TNFα + AA group, co-cultured with TNFα (10 ng/ml) and AA (100 µM). All data are normalized to the band density of β-actin. *P<0.05; **P<0.01. AA, ascorbic acid; AMPK, 5′AMP-activated protein kinase; Fgf21, fibroblast growth factor 21; Fgfr2, fibroblast growth factor receptor 2; HMW, high molecular weight; p, phosphorylated; TNFα, tumor necrosis factor α.

Fgfr2 knockdown decreases the AA-induced secretion of adiponectin. (A) Fgfr2 mRNA and (B) protein levels from Scr siRNA or Fgfr2 siRNA-transfected cells. (C) Total adiponectin and (D) HWM adiponectin levels were determined by ELISA. All data are expressed as the mean ± standard error of the mean. *P<0.05. AA, ascorbic acid; Fgfr2, fibroblast growth factor receptor 2; HMW, high molecular weight; Scr, scramble; siRNA, small interfering RNA; TNFα, tumor necrosis factor α.

Fgfr2 knockdown suppresses the inhibitory effects of AA on cell stress. Hif1α (A) mRNA and (B) protein expression levels were assessed in HepG2 cells by RT-qPCR and ELISA, respectively. The gene expression of (C) Glut1 and (D) Vegfa, (E) Mcp1 and (F) Il-6, (G) Grp78 and (H) Sxbp1 were determined by RT-qPCR. Data are expressed as fold changes compared with Scr siRNA. *P<0.05; **P<0.01. (I) Schematic model of the effects of AA on hepatocyte stress. AA treatment was proposed to be beneficial for relieving cell stress (hypoxia, inflammation and ER stress) in hepatocytes via the regulation of the FGF21/FGFR2/adiponectin pathway, which may improve NAFLD/NASH. AA, ascorbic acid; ER, endoplasmic reticulum; FGF21, fibroblast growth factor 21; Fgfr2, fibroblast growth factor receptor 2; Glut1, glucose transporter 1; Grp78, glucose-regulated protein, 78 kDa; HIF1α, hypoxia inducible factor 1α; IL-6, interleukin-6; Mcp1, monocyte chemoattractant 1; NAFLD, non-alcoholic fatty liver disease; NASH, non-alcoholic steatohepatitis; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Scr, scramble; siRNA, small interfering RNA; Sxbp1, spliced X-box-binding protein 1; TNFα, tumor necrosis factor α; Vegfa, vascular endothelial growth factor A.

Primers used for reverse transcription-quantitative polymerase chain reaction analysis.

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
β-Actin GCAAAGACCTGTACGCCAACA TGCATCCTGTCGGCAATG
Vegfa TTGCCTTGCTGCTCTACCTCCA GATGGCAGTAGCTGCGCTGATA
Glut1 TTGCAGGCTTCTCCAACTGGAC CAGAACCAGGAGCACAGTGAAG
Mcp1 AGAATCACCAGCAGCAAGTGTCC TCCTGAACCCACTTCTGCTTGG
IL-6 AGACAGCCACTCACCTCTTCAG TTCTGCCAGTGCCTCTTTGCTG
Grp78 CTGTCCAGGCTGGTGTGCTCT CTTGGTAGGCACCACTGTGTTC
Sxbp1 CTGCCAGAGATCGAAAGAAGGC CTCCTGGTTCTCAACTACAAGGC
Fgfr2 GTGCCGAATGAAGAACACGACC GGCGTGTTGTTATCCTCACCAG
Fgf21 CTGCAGCTGAAAGCCTTGAAGC GTATCCGTCCTCAAGAAGCAGC
Hif1α GAACGTCGAAAAGAAAAGTCTCG CCTTATCAAGATGCGAACTCACA

Fgf21, fibroblast growth factor 21; Fgfr2, fibroblast growth factor receptor 2; Glut1, glucose transporter 1; Grp78, glucose-regulated protein, 78 kDa; HIF1α, hypoxia inducible factor 1α; IL-6, interleukin-6; Mcp1, monocyte chemoattractant 1; Sxbp1, spliced X-box-binding protein 1; Vegfa, vascular endothelial growth factor A.

Fgfr2 siRNA primer used for transfection.

siRNA Forward primer (5′-3′) Reverse primer (5′-3′)
Fgfr2-1 GCCCUCCUUCAGUUUAGUUTT AACUAAACUGAAGGAGGGCTT
Fgfr2-2 GGACAAAGAGAUUGAGGUUTT AACCUCAAUCUCUUUGUCCTT
Fgfr2-3 CCAGAGGCAUGGAGUACUUTT AAGUACUCCAUGCCUCUGGTT

Fgfr2, fibroblast growth factor receptor 2; siRNA, small interfering RNA.