Ophiopogon japonicus was obtained from farms in Cixi (Zhejiang, China). MO-B was extracted from Ophiopogon japonicus using high-speed counter-current chromatography (19) and the yield was ~0.2–0.4 mg/g in tuber roots of Ophiopogon japonicus. High-performance liquid chromatography (HPLC) was conducted to measure the purity of MO-B, which was >97% (Fig. S1).HPLC was performed using a Shimadzu C18 column (5 µm 250×4.6 mm). The volume ratio of mobile solvents A (water) and B (acetonitrile) was maintained at 35:65, and the temperature was set at 30°C. The flow rate of the mobile phase was 1 ml/min. The detection wavelength was 285 nm. MO-B was then dissolved to 10, 20, 40 and 50 µM in dimethyl sulfoxide for cell treatment.

Antibodies targeting Bax (ab182733), Bcl-2 (ab182858), cleaved caspase-3 (ab32042), neutrophil cytochrome b light chain (p22phox; ab80896) and GAPDH (ab9482), goat anti-mouse horseradish peroxidase IgG (ab6789) and goat anti-rabbit IgG horseradish peroxidase (ab6721) secondary antibodies, were purchased from Abcam. Cell Counting Kit-8 (CCK-8), ROS and malondialdehyde (MDA) detection kits, radioimmunoprecipitation assay (RIPA) lysis buffer, a BCA Protein Assay kit and superoxide dismutase (SOD) assay kit with WST-8 were purchased from Beyotime Institute of Biotechnology.

HUVECs were obtained from Procell Life Science & Technology Co., Ltd. and the STR validation of the cell line was performed by the company, which revealed no cross contamination of human cells. HUVECs were grown in Ham's F-12 K medium with 0.1 mg/ml Heparin, 0.03–0.05 mg/ml Endothelial Cell Growth Supplement, 10% fetal bovine serum and 1% penicillin/streptomycin (Procell Life Science & Technology Co., Ltd.), and maintained at 37°C in a humidified incubator with 5% CO₂. The cells were sub-cultured every 2–3 days with 0.25% trypsin digestion. Cells between passages 5–12 were used for the subsequent the experiments.

To evaluate cell viability, cells were enzymatically harvested as aforementioned, counted in a hemocytometer and sub-cultured in 96-well plates at a density of 5×10³ cell/well. HUVECs cultivated for 24 h in medium at 37°C without (control) or with MO-B (10, 20, 40 and 50 µM) were incubated with H₂O₂ (1,000 µM) for 60 min. Finally, the medium was discarded and 100 µl fresh medium containing 10% CCK-8 agent was added to each well for incubation for 1 h at 37°C. The absorbance at 450 nm was measured using a Varioskan Flash reader (Thermo Fisher Scientific, Inc.).

HUVECs were cultured at a density of 2×10⁵ cells/well in 6-well plates and cultured overnight at 37°C before being treated for 24 h without (control) or with MO-B (10, 20, 40 and 50 µM), and then stimulated with H₂O₂ (1,000 µM) for 6 h. The aforementioned assay kits (Beyotime Institute of Biotechnology) were then used to measure the MDA levels and SOD activity, respectively, according to the manufacturer's protocols.

The level of intracellular ROS was determined by the change in fluorescence emission of the fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCFH-DA). Briefly, 2×10⁵ HUVECs were cultured into 6-well plates at 37°C and treated with the indicated concentrations of MO-B (10, 40 and 50 µM) for 24 h, followed by treatment with H₂O₂ (1,000 µM) for 1 h. Cells were trypsinized and washed with PBS, and then incubated with 10 mmol/l DCFH-DA for 30 min at 37°C. Subsequently, cells were washed with PBS twice and analyzed using a BD ACCURIC6 PLUS flow cytometer and BD Accuri C6 software (BD Biosciences).

After treatment with or without MO-B (10, 20 and 40 µM) for 24 h, cells were exposed to 1,000 µM H₂O₂ for 6 h and then washed with ice-cold PBS. Apoptosis was analyzed using an Annexin V-fluorescein isothiocyanate/propidium iodide Apoptosis Detection Kit (Beyotime Institute of Biotechnology). Cells were stained according to the manufacturer's instructions. The proportion of apoptotic cells in 1×10⁵ labeled cells was quantified using a BD Accuri C6 Plus flow cytometry and BD Accuri C6 software (BD Biosciences).

Cells were pretreated at 37°C without (control) or with MO-B (10, 20 and 50 µM) for 24 h and then exposed to 1,000 µM H₂O₂ for 6 h. The cells were then used for RNA extraction.

Total RNA extraction was performed using the RNAiso Plus reagent (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocols. The concentration of RNA was determined by measuring the absorbance at 260 and 320 nm using a Nanodrop 2000 (Thermo Fisher Scientific, Inc.). Complementary DNA was generated from 500 ng total RNA using Super Script II Reverse Transcriptase (Takara Biotechnology Co., Ltd.), according to the manufacturer's protocol. The reverse transcription reaction was as follows: 37°C for 30 min and 85°C for 5 min. qPCR analysis was performed using SYBR^® GREEN PCR master mix in a reaction volume of 20 µl using a 7500 Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The annealing temperature used was 60°C for 30 sec. Relative gene expression was calculated by the 2^−ΔΔCq method (20), and the values were normalized to the endogenous reference β-actin. Primer sequences were as follows (forward, 5′-3′ and reverse, 5′-3′): p22phox, CAGTGGTACTTTGGTGCCTACTCCandGGTGGAGCCCTTCTTCCTCT; Bcl-2, CGACGACTTCTCCCGCCGCTACCGC and CCGCATGCTGGGGCCGTACAGTTCC; Bax: TCCACCAAGAAGCTGAGCGAG and GTCCAGCCCATGATGGTTCT; caspase-3, AATTGTGGAATTGATGCGTGATGT and ATAATAACCAGGTGCTGTGGAGTA; β-actin, GTGGGGCGCCCCAGGCACC and CTCCTTAATGTCACGCACGATTTC.

Cells were pretreated with MO-B (10, 20, 40 and 50 µM) for 24 h and then exposed to 1,000 µM H₂O₂ for 6 h. Subsequently, the cells were collected and lysed in RIPA lysis buffer containing 2 mM PMSF, and the protein concentration in cell lysates was determined by BCA assay. Cell lysates containing 60 µg total protein were subjected to 12% SDS-PAGE (Bis-Tris Midi-Gels; Thermo Fisher Scientific, Inc.) and then transferred to PVDF membranes. The membranes were blocked in TBS with 0.1% Tween-20 (TBST) containing 1% BSA at 4°C overnight, and then incubated with primary antibodies (1:5,000) in TBST at room temperature for 2 h. The membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:2,000) in TBST at room temperature for 2 h. Proteins were visualized using an ECL kit (Beyotime Institute of Biotechnology) and detected using a Chemi Doc XRS imaging system (Bio-Rad Laboratories). GAPDH was used as a loading control.

Data are expressed as the mean ± standard error from three independent experiments. Statistical analysis was performed with statistical software SPSS 18.0 (SPSS, Inc.). Data were analyzed by one-way analysis of variance followed by the Least Significant Difference test. P<0.05 was considered to indicate a statistically significant difference.

To determine the protective effects of MO-B on HUVECs under H₂O₂ stress, a CCK-8 assay was performed. As presented in Fig. 1, H₂O₂ treatment for 24 h significantly inhibited HUVEC viability compared with in untreated cells. However, pretreatment of cells with MO-B for 24 h at concentrations of 10, 20, 40 and 50 µm significantly ameliorated the effects of H₂O₂ on cytotoxicity compared with H₂O₂ treatment alone; cell activity increased by 30% under 50 µM MO-B treatment (Fig. 1). This suggested that MO-B could protect endothelial cells against H₂O₂-induced cell death in a concentration-dependent manner.

To further examine whether MO-B could protect HUVECs via an antioxidant mechanism, the intracellular production of ROS and MDA, and SOD activity were investigated. As presented in Fig. 2, intracellular ROS levels were significantly increased in the H₂O₂-treated group compared with the control group, while 40 and 50 µM MO-B significantly reduced ROS levels compared with H₂O₂ treatment alone. This indicated that H₂O₂ exerts its cytotoxicity via oxidative injury and MO-B can mitigate such injury. Similarly, the levels of MDA, which is an indicator of lipid peroxidation (21), were significantly increased under H₂O₂ treatment compared with the control, but decreased with MO-B pretreatment compared with H₂O₂ treatment alone (Fig. 3A). This suggested that the increased ROS and MDA produced are scavenged by MO-B, indicating its antioxidative properties. Subsequently, the antioxidant enzyme SOD was examined. SOD is a type of superoxide free radical scavenger that naturally occurs in living organisms, and is an active substance capable of eliminating harmful substances produced during metabolic processes (22). In our study, SOD activity was significantly decreased in HUVECs treated with H₂O₂ for 6 h compared with untreated cells, while significant increases with MO-B pretreatment were observed compared with H₂O₂ treatment alone (Fig. 3B).

To further illustrate the effects of MO-B on H₂O₂-induced vascular endothelial cell injury, cell apoptosis was measured by the Annexin V-FITC and PI double-staining method, and the number of apoptotic cells of HUVECs was determined by flow cytometry. As shown in Fig. 4B, the percentage of double-positive cells (upper right quadrant; 36.1%) was significantly increased compared with the normal group (20.3%) (Fig. 4A and F). This level of apoptosis was significantly ameliorated by the three concentrations of MO-B tested, ranging from 33.8 to 20.8%, compared with H₂O₂ treatment alone (Fig. 4C-F). These results indicate that MO-B could protect HUVECs from H₂O₂-induced apoptosis. Apoptosis is an orderly cell death process regulated by apoptosis-associated genes, including the Bcl-2 family and caspases family and cytochrome c. The Bcl-2 family is composed of proteins that regulate apoptosis by inducing (pro-apoptotic) or inhibiting (anti-apoptotic) this process (23). The Bcl-2 family plays a dual role in the regulation of apoptosis (24). Thus, the present study detected the mRNA expression of Bcl-2 in HUVECs, which prevents apoptosis, and that of Bax, which promotes apoptosis. As presented in Fig. 5A and B, H₂O₂ significantly promoted Bax mRNA expression, but suppressed that of Bcl-2 in HUVECs compared with the control group. Pretreatment of MO-B led to significantly downregulated Bax and increased Bcl-2 expression compared with H₂O₂ treatment alone. Similar results were observed for protein expression in which H₂O₂ alone markedly increased the level of Bax but decreased the Bcl-2 protein expression, while MO-B could dose-dependently ameliorate the effects of H₂O₂ (Fig. 6). The results indicated that H₂O₂ induced cell apoptosis, which was reversed with MO-B pretreatment.

Furthermore, caspases belong to a family of cysteine proteases that are key mediators of programmed cell death or apoptosis (25). Caspase-3 is a marker of apoptosis, and the initiator and executor of this process (26). I addition, caspase-3 is the hub of various apoptotic signal transduction pathways outside the cell, and is the most important apoptotic protease, which is activated in the early stage of apoptosis (27). Activated caspase-3 causes a series of cascade reactions, which eventually lead to apoptosis. Hence, the activity of caspase-3 in HUVECs was examined. In Fig. 5C, H₂O₂ significantly increased caspase-3 mRNA expression in HUVECs compared with the control group. Pretreatment with MO-B (10, 20 or 50 µM) significantly inhibited caspase-3 mRNA expression compared with H₂O₂ treatment alone. Western blotting also revealed the same trend in active caspase-3 protein expression. There was an increase in active caspase-3 expression caused by H₂O₂ treatment, which could be inhibited by administration of MO-B (Fig. 6). Collectively, these results further suggested the pivotal role of caspase-3 activation in H₂O₂-induced apoptosis, as well as the anti-apoptotic effect of MO-B.

NADPH oxidase serves a key role in ROS generation, and p22phox is a modulatory subunit of NADPH oxidase (28). Thus, the effects of MO-B on H₂O₂-induced p22phox mRNA and protein expression in HUVECs were examined. A notable increase in p22phox mRNA levels was observed in the H₂O₂ group. Pretreatment of HUVECs with MO-B (>10 µM) significantly reversed H₂O₂-induced p22phox expression (Fig. 5D). A similar result was also observed for protein expression. H₂O₂ alone markedly increased the level of p22phox protein expression by 2-fold compared with the control group, while MO-B could dose-dependently attenuate its protein expression (Fig. 6). These results suggested that MO-B may exert its effects on p22phox expression by modulating the NADPH pathway.