The synthetic DNA fragment targeting RXRα (GGATCCCGCACTATGGAGTGTACAGCTCAAGAGAGAGCTGTACACTCCAGTGCTTTTTTCCAAAAGCTT, synthesized by Western Biomedical Technology, Ltd.) and the vector SD1211 (Biovector Science Lab, Inc.) were modified with BamHI and HindIII (Takara Bio, Inc.) at 37°C for 30 min. After gel purification, the digested DNA fragment and the vector were ligated using T4 DNA ligase (Takara, Bio, Inc.) and then transfected into DH5α competent cells (Tiangen Biotech Co., Ltd.) for plasmid amplification. After selection and screening, plasmids were sequenced to confirm successful construction of the shRNA plasmid.

The human PMC cell line HMrSV5 was obtained from the Type Culture Collection of the Cell Bank of Chinese Academy of Sciences. This cell line was established by Professor Pierre Ronco, Hospital Tenon (Paris, France) (48) and had been used in a number of previous studies (49–52). HMrSV5 cells were cultured in DMEM containing 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin in an incubator at 37°C supplemented with 5% CO₂ and a saturated humidity. To investigate the effects of astragaloside IV (Yuanye Bio-Technology Co., Ltd.) on PMCs in high glucose-based PD fluids, HMrSV5 cells were divided into four groups: i) Normal + vehicle control group, cells were cultured in regular media and treated with DMSO; ii) PD model + vehicle group, cells were cultured in PD fluids and treated with DMSO; iii) normal + astragaloside IV group, cells were cultured in regular media and treated with astragaloside IV; and iv) PD model regular astragaloside IV group, cells were cultured in PD fluids and treated with astragaloside IV. To investigate the role of RXRα in maintaining PMCs in PD fluids, HMrSV5 cells were divided into four groups: i) Blank + vehicle control group, cells were transfected with the SD1211 empty plasmid, cultured in PD fluids and treated with DMSO; ii) RXRα shRNA plasmid + vehicle group, cells were transfected with the RXRα shRNA plasmid, cultured in PD fluids and treated with DMSO; iii) blank + astragaloside IV group, cells were transfected with the SD1211 empty plasmid, cultured in PD fluids and treated with astragaloside IV; and iv) RXRα shRNA + astragaloside IV group, cells were transfected with the SD1211 RXRα shRNA plasmid, cultured in PD fluids and treated with astragaloside IV. Cells in each group were first transfected with the appropriate plasmid, for 6 h and then cultured in fresh media for 24 h. These cells were then cultured in PD fluids and astragaloside IV or DMSO was added. The PD fluids used for cell culture were made from original PD fluids with the addition of 10% FBS. The original PD fluids (Lactate-G4.25%; cat. no. 6AB9896) were purchased from Guangzhou Baxter Medical Products Co., Ltd. Its components include 4.25 g glucose, 538 mg sodium chloride, 26 mg calcium chloride, 5.1 mg magnesium chloride and 448 mg sodium lactate/100 ml. The final concentration of astragaloside IV in the normal media or PD fluids was 40 µg/ml. Astragaloside IV was dissolved in DMSO to make a 40 mg/ml stock solution. The same volume of DMSO and astragaloside IV stock solution was used to treat cells. All cells were cultured and treated with pertinent chemicals at 37°C.

The CCK-8 assay was used to determine the viability of HMrSV5 cells. To investigate the effects of astragaloside IV on the viability of PMCs in PD fluids, HMrSV5 cells in the log phase growth from each group were seeded in triplicate into 96-well plates at a density 1×10⁵ cells/cm² and cultured overnight. Cells were treated with astragaloside IV, PD and their respective controls for 24, 48 or 72 h. To investigate the role of RXRα in maintaining the viability of PMCs in PD fluids, HMrSV5 cells from each group were seeded in triplicate into 96-well plates at a density 1×10⁵ cells/cm² and cultured overnight. Following overnight culture, cells were transfected with SD1211 empty vector (0.4 µg/cm²) or RXRα shRNA plasmid (0.4 µg/cm²) for 6 h and then cultured in fresh media for 24 h. These cells were then treated with astragaloside IV, PD and DMSO for 24, 48 or 72 h. Cell viability was determined using a CCK-8 kit (Sigma-Aldrich; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The absorbance (A) at 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Inc.). A 96-well plate with medium and CCK reagent was used as a blank control. Cell viability (%)=[A (experiment)-A (blank plate)]/A (normal + vehicle control group) ×100; or cell viability (%)=[A (experiment)-A (blank plate)]/A (blank + vehicle control group) ×100.

Flow cytometry was used to examine the level of apoptosis in HMrSV5 cells. To investigate the effects of astragaloside IV on the level of apoptosis of PMCs in PD fluids, HMrSV5 cells were seeded into 6-well plates at a density 1×10⁵ cells/cm², cultured overnight and treated with astragaloside IV, PD and their respective controls for 48 h. To investigate the role of RXRα in apoptosis of PMCs in PD fluids, HMrSV5 cells were seeded into 6-well plates at a density 1×10⁵ cells/cm². Following overnight culture, cells were transfected with SD1211 empty vector (0.4 µg/cm²) or RXRα shRNA plasmid (0.4 µg/cm²) for 6 h and then cultured in fresh media for 24 h. These cells were then treated with PD and astragaloside IV or DMSO for 48 h. Cells were collected and the rate of apoptosis was determined using a EPICS XL flow cytometer (Beckman Coulter, USA) and Annexin V-PE Apoptosis Detection Kit I (BD Biosciences, 559763) according to the manufacturer's instructions. Briefly, cells were washed twice with cold PBS and then resuspended in 1X Binding Buffer (BD Biosciences, 51–66121E) at a concentration of 1×10⁶ cells/ml. Then, 100 µl of the solution (1×10⁵ cells) was transferred to a 5 ml culture tube and 5 µl of Annexin V-PE (BD Biosciences, 51-65875X) and 5 µl of 7-Amino-actinomycin D (7-AAD; BD Biosciences, 51-68981E) added. The cells were gently vortexed and incubated for 15 min at room temperature (25°C) in the dark. 1X binding buffer (400 µl) was added to each tube. Flow cytometry analysis was performed within one hour. The results were analyzed using CytExpert 1.2 software (Beckman Coulter, Inc.).

To investigate the effects of astragaloside IV on caspase-3 levels and EMT of PMCs in PD fluids, HMrSV5 cells were seeded in 6-well plates at a density 1×10⁵ cells/cm². After overnight culture, cells were treated with astragaloside IV, PD and their respective controls for 48 h. To investigate the role of RXRα on the caspase-3 levels and EMT of PMCs in PD fluids, HMrSV5 cells were seeded in 6-well plates at a density 1×10⁵ cells/cm². After overnight culture, cells were transfected with SD1211 empty vector (0.4 µg/cm²) or RXRα shRNA plasmid (0.4 µg/cm²) for 6 h and then cultured in fresh media for 24 h. These cells were then treated with astragaloside IV, PD and DMSO for 48 h. Cells were collected and lysed using RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% (v/v) NP40, 0.1% (w/v) SDS, 0.5% (w/v) sodium deoxycholate] with protease inhibitor PMSF (100 mM; Beyotime Institute of Biotechnology). Equal amounts of proteins (50 µg) were separated by SDS-PAGE on 10% gels and then transferred onto PVDF membranes. After blocking with 5% non-fat milk at room temperature for 2 h, membranes were incubated overnight at 4°C with the following primary antibodies: E-cadherin (1:500; Abcam, ab1416), α-smooth muscle actin (α-SMA; 1:500; Abcam, ab32575), caspase-3 (1:500; Abcam, ab32351), β-actin (1:500; Abcam, ab179467) or GAPDH (1:1,000; Cell Signaling Technologies, Inc., 2118). This was followed by incubation with horseradish peroxidase-coupled secondary antibodies (1:1,000; Cell Signaling Technologies, Inc.; 7074 and 7076). Bands were visualized using the Enhanced Chemiluminescence Reagent kit (EMD Millipore) and analyzed using the GDS8000 system GelDoc-It310 and software VisionWorks LS v6.5.2 (UVP, LLC).

HMrSV5 cells were transfected with SD1211 empty vector (0.4 µg/cm²) or RXRα shRNA plasmid (0.4 µg/cm²) using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) and Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.), which was added to cells, incubated for 4–6 h and then cultured with regular media. After 24 h of culture, total RNA was extracted from cells using a MiniBEST Universal RNA Extraction kit (Takara Bio, Inc., 9767), according to the manufacturer's instructions, and reverse transcribed using oligo dT primers and a PrimeScript II 1st Strand cDNA Synthesis kit (Takara Bio, Inc., 6210A) according to the manufacturer's instructions. The thermocycling conditions used for the reverse transcription was as follows: 30°C 10 min, 42°C 30–60 min, 95°C 5 min, and then chilled in ice. Relative mRNA levels were analyzed by RT-qPCR using a PowerUp SYBR Green Master Mix (Applied Biosystems) and an ABI 7500 fast cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). GAPDH was used for normalization. The relative RXRα mRNA levels were calculated using the 2^−ΔΔCq method after normalization (53). All experiments were repeated three times. The following primers were used: GAPDH forwards, AGATCCCTCCAAAATCAAGTGG and reverse, GGCAGAGATGATGACCCTTTT; RXRα forward, CGGGAAGGTTCGCTAAGCT, and reverse, TGTTCCAGGCATTTGAGCC. Primers were designed using Primer 5 according to reference sequences in NCBI and synthesized by Invitrogen (Thermo Fisher Scientific, Inc.).

Quantitative data are expressed as the mean ± standard deviation for three experimental repeats. All the data were analyzed using SPSS 17.0 software (SPSS, Inc.). Graphics for quantitative data were processed using Prism 5 (GraphPad). Statistical analysis of the difference among multiple groups was performed by one-way ANOVA followed by the post hoc Student-Newman-Keuls test. Statistical analysis of the difference in RXRα levels in HMrSV5 cells transfected with SD1211 empty vector and those transfected with RXRα shRNA plasmid was performed using Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

To study the effect of astragaloside IV on the viability of PMCs during high-glucose PD, HMrSV5 cells were treated with PD fluid and astragaloside IV, and cell viability was determined using a CCK-8 assay. The viability of HMrSV5 cells was decreased in the PD model + vehicle groups compared with the normal + vehicle controls (Fig. 1). Viability in the PD model group was increased significantly after treatment with astragaloside IV compared with the PD model + vehicle groups (Fig. 1). Under normal conditions, the viability of HMrSV5 cells was not affected by astragaloside IV (Fig. 1). These results suggested that astragaloside IV increased viability of PMCs cultured in PD fluid, but did not affect cell viability under normal conditions.

To examine the effect of astragaloside IV on the rate of apoptosis in PMCs during high glucose-based PD, PD fluid-treated HMrSV5 cells were used as a PD model. These cells were treated with astragaloside IV or vehicle control, and the rate of apoptosis was determined using flow cytometry. Additionally, the protein levels of caspase-3, a hallmark of apoptosis, were determined using western blotting. The number of apoptotic HMrSV5 cells was significantly increased in PD fluids compared with the normal control (Fig. 2A and B). Apoptosis was significantly reduced in PD model cells after treatment with astragaloside IV, while the HMrSV5 cells apoptosis was not affected by astragaloside IV under normal conditions (Fig. 2A and B). Caspase-3 protein levels in HMrSV5 cells were significantly increased in the PD model group compared with the normal control. Caspase-3 levels were significantly decreased in the PD model cells following treatment with astragaloside IV (Fig. 2C). Caspase-3 protein levels were not affected by astragaloside IV under normal conditions (Fig. 2C). These results suggested that astragaloside IV inhibited apoptosis of PMCs in the PD model, but that astragaloside IV did not affect apoptosis under normal conditions.

To investigate the effect of astragaloside IV on EMT of PMCs in PD, HMrSV5 were treated with high-glucose PD fluid and astragaloside IV, and the levels of E-cadherin and α-SMA were determined using western blot analysis. The level of E-cadherin was decreased in HMrSV5 cells cultured in PD fluid compared with the normal control (Fig. 3). The level of E-cadherin in the PD model was significantly increased by treatment with astragaloside IV (Fig. 3). The level of α-SMA was significantly increased in HMrSV5 cells cultured in PD fluid compared with the normal control (Fig. 3). The level of α-SMA was significantly decreased in the PD model after treatment with astragaloside IV (Fig. 3). The levels of both E-cadherin and α-SMA were not affected by astragaloside IV under normal conditions (Fig. 3). These results suggested that astragaloside IV inhibited PMC EMT induced by PD fluid, but did not affect PMC EMT under normal conditions.

To knockdown the expression of RXRα in HMrSV5 cells, the RXRα shRNA plasmid was constructed using the SD1211 vector and transfected into HMrSV5 cells. The relative expression level of RXRα mRNA was determined using RT-qPCR to examine the effect and efficiency of RXRα shRNA on RXRα expression in HMrSV5 cells. The level of RXRα mRNA was decreased by ~80% in the HMrSV5 cells after transfection with SD1211 RXRα shRNA compared with the empty vector control (Fig. 4). These data suggested that RXRα expression was significantly and efficiently reduced in HMrSV5 cells by the SD1211 RXRα shRNA plasmid.

To examine the role of RXRα in maintaining the viability of PMCs during high glucose-based PD, HMrSV5 cells were transfected with SD1211 RXRα shRNA or empty SD1211, these cells were treated with PD fluids and astragaloside IV or vehicle control, and the cell viability was determined using the CCK-8 assay. The results showed that the viability of HMrSV5 cells treated with vehicle or astragaloside IV was decreased after RXRα shRNA transfection compared with the empty vector transfections (Fig. 5). Treatment with astragaloside IV resulted in increases in the viability of HMrSV5 cells after RXRα shRNA or blank vector transfection compared with the vehicle control treatment (Fig. 5). These results suggested that a decrease in the level of RXRα results in reduced viability of PMCs in PD fluid. Therefore, RXRα is required to maintain the viability of PMCs in PD fluid.

To examine the role of RXRα in the apoptosis of PMCs during high glucose-based PD, HMrSV5 cells were transfected with SD1211 RXRα shRNA or SD1211 empty vector, these cells were treated with PD fluid and astragaloside IV or vehicle control. The rate of apoptosis was determined using flow cytometry and the level of caspase-3 was determined using western blotting. The results showed that the rate of apoptosis in HMrSV5 cells treated with vehicle or astragaloside IV were increased after RXRα shRNA transfection compared with the blank shRNA transfection (Fig. 6A and B). Treatment with astragaloside IV resulted in decreased apoptosis of HMrSV5 cells transfected with RXRα shRNA or blank vector compared with the vehicle control treatments (Fig. 6A and B). Similar changes in the levels of caspase-3 were observed (Fig. 6C). These results suggested that a decrease in the level of RXRα resulted in an increase in apoptosis and the level of caspase-3 in PMCs cultured in PD fluid. Therefore, RXRα may be involved in reducing the apoptosis of PMCs in PD fluids.

To examine the role of RXRα in EMT of PMCs during high glucose-based PD, HMrSV5 cells were transfected with SD1211 RXRα shRNA or SD1211 empty vector, and cultured in PD fluid with astragaloside IV or vehicle control. The levels of E-cadherin and α-SMA were determined using western blot analysis. The level of E-cadherin in HMrSV5 cells treated with vehicle or astragaloside IV were decreased after RXRα shRNA transfection compared with the blank shRNA transfections (Fig. 7). Treatment with astragaloside IV resulted in an increase in the level of E-cadherin in HMrSV5 cells after RXRα shRNA or blank vector transfections compared the vehicle control treatments (Fig. 7). By contrast, the level of α-SMA in HMrSV5 cells treated with vehicle or astragaloside IV were increased after RXRα shRNA transfection compared with the empty shRNA transfections (Fig. 7). Treatment with astragaloside IV resulted in a decrease in the level of α-SMA in HMrSV5 cells after RXRα shRNA or empty vector transfections compared with the vehicle control treatments (Fig. 7). These results suggested that a decrease in the level of RXRα resulted in an increase in EMT in PMCs in PD fluid. Therefore, RXRα may be required inhibit EMT in PMCs in PD fluid.