Osteoarthritis (OA) is one of the most prevalent types of chronic joint diseases. Chondrocytes survival is closely associated with the destruction of joints in patients with OA. Long noncoding RNAs (lncRNAs) serve a critical role in OA. However, to the best of our knowledge, the role of lncRNAs NR024118 in OA has not been examined. In the present study, the expression levels of NR024118 in lipopolysaccharide (LPS)-induced chondrocytes was measured using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and the apoptosis levels of cells was determined using flow cytometry. The levels of scavenged reactive oxygen species and expression levels of the antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT), and heme oxygenase-1 (HO-1) were measured using specialized detection kits. The expression of interleukin (IL)-1β, IL-6 and IL-18 were measured using ELISA. Expression of the cell apoptosis markers Bcl-2, Bax, Bcl-2-like protein 11, NF-κB, phosphorylated (p)-NF-κB inhibitor β (IκBβ), IκBβ, p-transcription factor p65 (p65) and p65, and nuclear factor erythroid-2 related factor 2 (Nrf2) signaling pathways-associated proteins, Nrf2, HO-1 and quinone oxidoreductase-1 were detected by western blot analysis and RT-qPCR. The results indicated that in ATDC5 cells, apoptosis, oxidative stress and inflammation were significantly increased and the expression level of NR024118 was significantly decreased by LPS-mediated induction. NR024118 overexpression significantly reversed the effects of LPS treatment in the ATDC5 cell line. In addition, the overexpression of NR024118 decreased NF-κB expression levels and activated the Nrf2 signaling pathways in LPS-induced ATDC5 cells. The present study demonstrated that NR024118 attenuated the effects of LPS-induction on ATDC5 cells. These results suggest that NR024118 may be a potential target for diagnosis and treatment of OA.
Osteoarthritis (OA) is identified as the degradation of articular cartilage, and it affects >43 million people globally. It is the most common cause of disability and disproportionately affects the elderly (
Long noncoding RNAs (lncRNAs) are noncoding transcripts that are >200 nucleotides in length and lack protein encoding capacity (
NF-κB is a well-studied and key inflammatory molecule. Activation of the NF-κB pathway results in the production of pro-inflammatory cytokines, including tumor necrosis factor α, interleukin (IL)-1β and IL-6 (
In the present study, the potential effects of NR024118 on apoptosis and inflammatory damage in LPS-treated chondrocytes were measured. Furthermore, the effects of NR024118 on LPS-induced activation of the NF-κB signaling pathways and inhibition of the Nrf2 signaling pathway were examined. The results of the present study may provide insight into the identification of novel therapeutic and diagnostic targets for diagnosing and treating patients with OA.
The murine chondrogenic ATDC5 cell line was obtained from the Cell Bank Cell Engineering Division, RIKEN BioResource Research Center and cultured in DMEM/Ham Nutrient Mixture F12 (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a humidified incubator with 5% CO2. Cells were treated with 5 µg/ml LPS (5 mg/ml; Sigma-Aldrich; Merck KGaA) for 5 h to stimulate inflammatory injury.
The NR024118 sequence (TCAAAGACCACCACCATCTTCCTCAATGGCAACCGCGAGCGGCCCTTGGATGTGTTTTGTGACATGCAGACTGACGGAGGAGGTTGGCTGGTGTTCCAGCGCCGCATGGACGGACAGACAGACTTCTGGAGAGACTGGGAGGAGTACGCCCATGGTTTTGGGAACATCTCCAGGGAATTCTGGCTGGGCAATGAGGCCCTTCACAGCCTCACGCAGGCTGGAGACTACTCTATGCGTGTGGACCTGCGGGCCGGAAAGGAAGCCGTGTTCGCCCAGTATGACTTCTTCCGAGTAGACTCAGCGAAGGAGAACTATCGTCTACACCTAGGGGGCTACCATGGGACCGCGGGTGACTCTATGAGCTACCACAGCGGCAGTGCCTTTTCTGCCCGTGATCGAGACCCCAATAACTTGCTCATCTCCTGCGCTGTCTCCTATCGTGGGGCTTGGTGGTACAGGGACTGTCACTACGCCAATCTCAATGGGCTCTATGGGAGCACAGTGGATCACCAGGGAGTGAGCTGGTACCACTGGAAGGGCTTCGAGTTCTCGGTGCCCTTCACGGAAATGAAGCTGAGACCCAGAAACTTCCAGGCCCCCACCAGGGGCACCTGAGCCTGCTGCCCACCTCACTCACACCCTGGTATGACTGCCGAGCACTGAGGGGTTGTGCCCAGAGAAGAGCCAGTGTGTCTCTACTGTGCCTAGCTCACCGAGGAAGCCTTCTCTGCCACAGTCTCACAGCACCATGTTTACAGGGGGGAGGGGAGGGAAATGGAGCAATAAAGGAGAA) was synthesized and subcloned into a pcDNA3.1 vector (Invitrogen; Thermo Fisher Scientific, Inc.). The pcDNA3.1-NR024118 (NR024118) or empty vector was transfected into chondrocytes using Lipofectamine® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols, and the concentration is as followed: pcDNA 3.1: Lipofectamine=2 µg: 4 µl. After 48 h, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to evaluate the efficiency of the transfections.
Cell viability assay was assessed using a Cell Counting Kit-8 (CCK-8) assay Dojindo Molecular Technologies, Inc.). Briefly, cells (5×103 cells/well) were seeded in a 96-well cell culture plate following LPS treatment and/or transfection with pcDNA3.1-NR024118 and 20 µl CCK-8 solution was added into each well and incubated at 37°C for 2 h. The absorbance at 450 nm of each well was measured using a microplate reader (Bio-Rad Laboratories, Inc.).
Cell apoptosis was detected using fluorescein isothiocyanate (FITC)-Annexin V/propidium iodide (PI) staining (BD Biosciences). Briefly, following LPS treatment and/or transfection with pcDNA3.1-NR024118, ATDC5 cells were collected and stained with 10 µl Annexin V-FITC and 5 µl PI in the dark at 37°C for 25 min. Subsequently, the percentage of apoptotic cells were determined using flow cytometry (Guava Technologies, Inc.; Luminex Corporation). FlowJo software version 10.0 (FlowJo LLC) was used to analyze the data.
The concentrations of IL-1β, IL-6 and IL-18 were determined using specific ELISA kits (Mouse IL-1β/ IL-1F2 Quantikine ELISA kit, cat. no. MLB00C; Mouse IL-6 Quantikine ELISA kit, cat. no. M6000B, and Mouse IL-18 ELISA, cat. no. 7625, respectively; R&D Systems, Inc.,) according to the manufacturer's protocols.
The intracellular ROS levels were measured using the probe CM-H2DCFDA (Invitrogen; Thermo Fisher Scientific, Inc.). Briefly, following LPS treatment and/or transfection with pcDNA3.1-NR024118, the cells were incubated with DCF-DA at 37°C for 30 min. Subsequently, the cells were trypsinized and suspended in PBS. Cells were added with PI (1 µg/ml) on ice in the dark, and the fluorescence intensities were measured at 485 and 535 nm using Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter, Inc.). Acquisition and analysis of the data were performed the software of the flow cytometer.
The activity of SOD was determined using a SOD assay kit (cat. no. A001-3-2; Nanjing Jiancheng Bioengineering Institute). MDA levels were determined using an MDA assay kit (cat. no. A003-1-2; Nanjing Jiancheng Bioengineering Institute) and CAT levels were examined using a CAT assay kit (cat. no. A007-1-1; Nanjing Jiancheng Bioengineering Institute) according to the manufacturers' protocols.
ATDC5 cells were lysed using RIPA lysis buffer (Beyotime Institute of Biotechnology) and supplemented with protease inhibitors (Roche Diagnostics). The protein concentration was quantified using a bicinchoninic acid assay kit (Pierce; Thermo Fisher Scientific, Inc.). A total of 20 µg protein per lane was resolved using 10% SDS-PAGE and transferred to a polyvinylidene fluoride membrane (EMD Millipore). The membrane was blocked in 5% skimmed milk at room temperature for 1 h and incubated with appropriate primary antibodies (dilution 1:1,000) at 4°C overnight. The primary antibodies used in the present study were: Anti-phosphorylated (p)-NF-κB inhibitor β (IκBβ; cat. no. ab59195; Abcam), anti-IκBβ (cat. no. ab32135; Abcam), anti-NF-κB transcription factor p65 (p65) antibody (cat. no. 8242; Cell Signaling Technology, Inc), anti-p-NF-κB p65 antibody (cat. no. 3033; Cell Signaling Technology, Inc), Bcl-2 (cat. no. ab196495; Abcam), Bax (cat. no. ab182733; Abcam), Bcl-2-like protein 11 (Bim; cat. no. ab7888; Abcam), Nrf2 (cat. no. 12721; Cell Signaling Technology, Inc), HO-1 (cat. no. 82206; Cell Signaling Technology, Inc), NQO1 (cat. no. 3187; Cell Signaling Technology, Inc) and GAPDH (cat. no. ab181603, Abcam). Subsequently, the membranes were incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (dilution 1:2,000; cat. no. sc-2005; Santa Cruz Biotechnology, Inc.) for 1 h at room temperature. The signals were visualized by enhanced chemiluminescence kit (GE Healthcare) and Image Lab™ Software version 4.1 (Bio-Rad Laboratories, Inc.) and protein expression levels were quantified using ImageJ version 1.46 (National Institutes of Health).
Total RNA from cultured cells was extracted using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A total of 2 µg RNA was reversed transcribed into cDNA using the PrimeScript™ RT reagent kit with DNA Eraser (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol using the following conditions: Initial incubation at 37°C for 15 min, followed by incubation at 85°C for 5 sec. NR024118 expression was quantified using SYBR1 Green RealTime PCR Master mix (Invitrogen; Thermo Fisher Scientific, Inc.) in an ABI PRISM® 7300 PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). PCR reactions were performed using the following conditions: Initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and anneal/extend at 63°C for 60 sec. The primers sequences were: NR024118 forward, 5′-GCTGCCCACCTCACTCAC-3′; NR024118 reverse, 5′-CTTTATTGCTCCATTTCCCTC-3′; Nrf2 forward, 5′-TTCCTCTGCTGCCATTAGTCAGTC-3′; Nrf2 reverse, 5′-GCTCTTCCATTTCCGAGTCACTG-3′; NQO-1 forward, 5′-AAGAGCCCTGATTGTACTGGC-3′; NQO-1 reverse, 5′-GCGTCCTTCCTTATATGCTAGAGA-3′; HO-1 forward, 5′-GTGACAGAAGAGGCTAAGACCG-3′; HO-1 reverse, 5′-ACAGGAAGCTGAGAGTGAGGAC-3′; GAPDH forward, 5′-GGGAAACTGTGGCGTGAT-3′; GAPDH reverse, 5′-GAGTGGGTGTCGCTGTTGA-3′. GAPDH was used as the endogenous control and the data was quantified using the 2−ΔΔCq method (
Data are presented as the mean ± standard deviation from at least 3 experimental repeats. Statistical analysis was performed using GraphPad Prism v.5 (GraphPad Software, Inc.). A one-way analysis of variance followed by Tukey's post hoc test or an unpaired two-tailed t-test was used to analyze the data. P<0.05 was considered to indicate a statistically significant difference.
Compared with the control group, NR024118 expression was significantly decreased in ATDC5 cells following treatment with LPS (
The effect of NR024118 on LPS-induced chondrocyte apoptosis was determined using a CCK-8 assay and flow cytometry. The results indicated that the levels of the LPS-induced decrease in cell viability and induction of apoptosis were decreased in cells transfected with NR024118 (
Following stimulation of cells with 5 µg/ml LPS, the levels of IL-18, IL-1β and IL-6 were significantly increased compared with the control group. Overexpression of NR024118 significantly decreased the expression of IL-1β, IL-6 and IL-18 in LPS-induced cells (
Western blot analysis was used to detect the activation of the NF-κB and Nrf2 signaling pathways in ATDC5 cells following LPS treatment and/or transfection with pcDNA3.1-NR024118 transfection. As indicated in
OA is a widespread joint disorder that plagues millions of people globally and is a major cause of disability in the elderly (
Inflammatory damage of the articular cartilage serves a vital role in articular cartilage degeneration and OA progression (
Recently, lncRNAs have been demonstrated to be involved in a variety of biological processes, and a number of different types of diseases, including OA. Numerous lncRNAs, including HOTAIR (
NF-κB activation exhibits a crucial role in the LPS-induced inflammatory response (
In conclusion, the present study demonstrated that NR024118 levels were downregulated in LPS-induced chondrocytes. NR024118 overexpression alleviated the LPS-induced cell apoptosis, oxidative stress and inflammatory injury through the NF-κB and Nrf-2 signaling pathways. These results suggested that NR024118 may be a potential target for diagnosis and treatment of patients with OA.
Not applicable.
The present study was supported by Nanjing Medical Science and Technique Development Foundation.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XM wrote the paper. XM, JT, and WZ performed the experiments. XM and JT analyzed the data. YZ designed the experiments and improved the manuscript. All authors read and approved the manuscript, and agreed to be accountable for all aspects of the study in ensuring that the integrity and accuracy of any part of the work are appropriately investigated and resolved.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
LPS induces the downregulation of NR024118 in ATDC5 cells. (A) NR024118 expression was detected by RT-qPCR. (B) Expression levels of NR024118 in ATDC5 cells transfected with pCDNA3.1-NR024118 (NR024118) or empty vectors were measured by RT-qPCR. Data are presented as the mean ± standard deviation. **P<0.01 and ***P<0.001 vs. control group. LPS, lipopolysaccharide; NR024118, pCDNA3.1-NR024118; NC, negative control; RT-qPCR, reverse transcription quantitative polymerase chain reaction.
Overexpression of NR024118 alleviates LPS-induced cell apoptosis in ATDC5 cells. (A) Cell viability was detected by CCK-8 assay. (B) Cell apoptosis was detected by flow cytometry. (C) Quantitative analysis of the flow cytometry data. (D) The expression levels of apoptosis-associated factors Bax, Bcl-2 and Bim was detected by western blot analysis. (E) Quantitative analysis the protein expression. Data are presented as the mean ± standard deviation. ***P<0.001 vs. control group. #P<0.05 and ##P<0.01 vs. LPS group. LPS, lipopolysaccharide; NR024118, pCDNA3.1-NR024118; NC, negative control; Bim, Bcl-2-like protein 11; FITC, fluorescein isothiocyanate.
Overexpression of NR024118 alleviates LPS-induced inflammatory injury in ATDC5 cells. The concentration of inflammatory cytokines (A) IL-18, (B) IL-6 and (C) IL-1β in the culture supernatant of ATDC5 cells was detected by ELISA. (D) ROS, (E) MDA, (F) SOD and (G) CAT expression were detected by specific commercial kits. Data are presented as the mean ± standard deviation. ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. LPS group. LPS, lipopolysaccharide; IL, interleukin; ROS, reactive oxygen species; SOD, superoxide dismutase; MDA, malondialdehyde; CAT, catalase; NR024118, pCDNA3.1-NR024118; NC, negative control.
Overexpression of NR024118 inhibits LPS-induced NF-κB pathway activation and promotes Nrf2 pathway activation in ATDC5 cells. (A) Western blot analysis was performed to evaluate the protein expression levels of p-IκBβ, t-IκBβ, p-p65 and t-p65 following treatment with 5 µg/ml LPS and/or pCDNA3.1-NR024118 transfection in ATDC5 cells. (B) Quantitative analyses of the ratios of p/t-IκBβ and (C) p/t-p65 were performed. (D) Western blot analysis was performed to evaluate the protein expression of NQO-1, NRF2 and HO-1 following treatment with 5 µg/ml LPS treatment and/or pCDNA3.1-NR024118 transfection in ATDC5 cells. Quantitative analyses of the protein expression of (E) NQO-1, (F) NRF2 and (G) HO-1 were performed. RT-qPCR was conducted to analyze the mRNA expressions of (H) NQO-1, (I) NRF2 and (J) HO-1 following treatment with 5 µg/ml LPS and/or pCDNA3.1-NR024118 transfection in ATDC5 cells. Data are presented as the mean ± standard deviation. *P<0.05, **P<0.01 and ***P<0.001 vs. control group. #P<0.05 and ##P<0.01 vs. LPS group. LPS, lipopolysaccharide; NR024118, pCDNA3.1-NR024118; NC, negative control; IκBβ, NF-κB inhibitor β; p65, transcription factor p65; p-, phosphorylated; t-, total; NQO-1, quinone oxidoreductase-1; NRF2, nuclear factor erythroid-2 related factor 2; HO-1, heme oxygenase-1.