The human gastric adenoma cell line BGC-823 (cat. no. TCHu 11) and human gastric adenoma cell line SGC-7901 (cat. no. TCHu 46) were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The human gastric epithelial cell line MKN-28 (cat. no. CL-0291) and the human gastric epithelial mucosa cells (GES; cat. no. CL-0563) were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China). The cells were cultured in RPMI 1640 medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 1:10 fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.), penicillin (1:100; Invitrogen; Thermo Fisher Scientific, Inc.) and streptomycin (1:100; Invitrogen; Thermo Fisher Scientific, Inc.) in a humidified atmosphere containing 5% CO₂ at 37°C.

The GC cell line SGC-7901 was cultured in medium without antibiotics for 24 h. miR-381 mimic (cat. no. 4464066) or miR-381 negative control (NC; cat. no. 4464059) (Ambion; Thermo Fisher Scientific, Inc.) were transfected into the cultured SGC-7901 cells (5,000 cells/well in a 96-well plate) at a final concentration of 10 nM using the Lipofectamine^® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The miR-381 NC was used as the negative control. Protein and total RNA were extracted from the transfected cells 72 h after transfection. TWIST1 small interfering RNA (siRNA; cat. no. sc-38604) was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). TWIST1 siRNA transfection was performed using the Lipofectamine^® 3000 reagent according to the manufacturer's instructions. Cells were harvested for further study 24 h post-transfection.

Total miRs and mRNAs were extracted from transfected and mock GC cells using TRIzol^® (Invitrogen; Thermo Fisher Scientific, Inc.). miRs were converted to cDNAs via PrimeScript miRNA cDNA Synthesis kit (cat. no. D350A; Takara Bio, Inc., Otsu, Japan) and mRNAs were converted to cDNAs by using the PrimeScript RT Master Mix kit (cat. no. DRR036A; Takara Bio, Inc.). miRNA RT was conducted under the following conditions: 42°C for 60 min and 85°C for 15 min. mRNA RT was conducted under the following conditions: 37°C for 15 min and 85°C for 1 min. miR-381 quantification was performed via TaqMan Universal PCR Master Mix with a miRNA-specific TaqMan minor groove binder probe (cat. no. 4426961; Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. RNA U6 was used as internal control for miR-381 quantification. The sequences for U6 were: F: 5′-GTGCTCGCTTCGGCAGCACATATAC-3′; R: 5′-AAAAATATGGAACGCTCACGAATTTG-3′. The sequences for GAPDH (cat. no. qHsaCEP0041396; Bio-Rad Laboratories, Inc.) and miR-381 (cat. no. 4426961; Invitrogen; Thermo Fisher Scientific, Inc.) were proprietary. The qPCR for TWIST1 was performed using PrimePCR™ SYBR^® Green Assay (cat. no. qHsaCED0043959; Bio-Rad Laboratories, Inc., Hercules, CA, USA). GAPDH was the internal control gene for TWIST1 quantification. qPCR was conducted under the following conditions: 95°C for 10 min, followed by 40 cycles at 95°C for 10 sec, 57°C for 20 sec and 72°C for 10 sec. Relative quantifications of miRs and mRNAs were calculated using the 2^−ΔΔCq method as previously described (23).

To further investigate the potential target of miR-318, potential genes were predicted using TargetScan 7.2 (www.targetscan.org) and miRBase (www.mirbase.org).

The wild-type (wt; GUUUUGUAAAUAUCUUUGUAUA) or mutant (mut; GUUUUGUAAAUAUCUCCACGCA) TWIST1 genes were cloned downstream of the luciferase gene in the pLUC Luciferase vector to construct the TWIST1 luciferase reporter vector (Qcbio S&T Co., Ltd.). miR-381 mimic or miR-381 NC were co-transfected with the TWIST1 luciferase reporter vector into the GC cell line SGC-7901 (10,000 cells/well in a 48-well plate) using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The transfected cells were cultured at 37°C for 48 h, harvested and lysed for the measurement of luciferase activity according to the manufacturer's instructions (Dual-Luciferase^® Reporter Assay system; Promega Corporation). The relative luciferase activity was normalized to Renilla luciferase activity.

An MTT assay was used to evaluate the effect of miR-381 on GC cell viability. GC cells transfected with miR-381 mimic or miR-381 NC were cultured in 96-well plates (5,000 cells/well). Cell viability was measured by MTT assay every 24 h according to the manufacturer's instructions. Following incubation with MTT reagent, formazan crystals were dissolved in DMSO and optical density was measured at 490 nm. For the colony formation assay, GC cells transfected with miR-381 mimic or miR-381 NC were cultured in 6-well plates for 2 weeks (500 cells/well), fixed with 100% methanol at room temperature (RTemp) for 15 min, and stained with 0.5% crystal violet at 4°C for 30 min to count the number of colonies using a light microscope (magnification, ×4).

Cell invasion and migration were assessed using a Transwell chamber coated with or without Matrigel (EMD Millipore), respectively, according to the manufacturer's protocol. miR-381 mimic or miR-381 NC transfected GC cells (100,000) were cultured in serum free medium and seeded in the upper chamber (pore size, 8 µm). The lower chamber contained the chemoattractant medium with 10% FBS. After 48 h, the cultured cells in the upper chamber were removed using a cotton swab, while the cells which had migrated to the reverse face were fixed with 4% methanol for 20 min at RTemp, and stained with giemsa for 15 min at RTemp to count the cell numbers using a light microscope (magnification, ×200).

miR-381 mimic or miR-381 NC transfected GC cells were cultured for 2 days in RPMI1640 medium. Harvested cells were stained with fluorescein isothiocyanate-Annexin V and propidium iodide (PI; Beyotime Institute of Biotechnology). A flow cytometry (FCM) assay was performed to evaluate cell apoptosis (BD FACSCalibur; BD Biosciences), and the data were analyzed with CellQuest Pro 7.5.3 software (BD Biosciences).

miR-381 mimic or miR-381 NC transfected GC cells were cultured for 2 days in 6-well plates. Cells were harvested and protein was extracted using a radioimmunoprecipitation assay buffer containing protease inhibitors (Beyotime Institute of Biotechnology). Protein concentration was measured using the bicinchoninic acid assay. The extracted proteins (50 µg) were separated by 10% SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane. The PVDF membrane was blocked with 5% milk in PBS-0.05% Tween 20 (PBST) for 2 h at RTemp, and incubated with the following primary antibodies (1:2,000): TWIST1, (cat. no. 46702) and GAPDH (cat. no. 5174; both Cell Signaling Technology, Inc.) for 2 h at RTemp. Following three washes with PBST, the PVDF membrane was incubated with anti-rabbit secondary antibodies (1:2,000; cat. no. 7074; Cell Signaling Technology, Inc.) for 1 h at RTemp. Following three washes with PBST, the target proteins were detected with an enhanced chemiluminescent kit (cat. no. P0018; Beyotime Institute of Biotechnology) and exposed on x-ray film.

Each experiment was repeated at least three times. SPSS 16.0 (SPSS, Inc., Chicago, IL, USA) was used to perform one-way analysis of variance and Tukey's HSD tests (post-hoc test) to identify statistical differences. The data are expressed as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

In order to determine the expression of miR-381 in human GC cells, total RNA was extracted from cultured cell lines, and the expression levels of miR-381 were measured via RT-qPCR. The relative expression of miR-381 was normalized to the endogenous U6 RNA expression. The expression of miR-381 (Fig. 1) was significantly decreased in GC cell lines compared with the immortalized human gastric epithelial GES cells (P<0.05). Notably, in SGC-7901 cells, the relative expression of miR-381 was ~0.24 relative to GES cells; therefore, SGC-7901 cells were used in the subsequent experiments.

To investigate the biological function of miR-381 in GC cells, the direct target gene of miR-381 was identified using the miRBase database. The search results indicated that TWIST1 was a potential target of miR-381 (Fig. 2A). Previous studies reported that TWIST1 is upregulated in GC, and that TWIST1 promotes GC cell proliferation (24,25), therefore miR-381 was hypothesized to regulate GC cells via TWIST1. To confirm whether TWIST1 is a direct target gene of miR-381, a dual luciferase assay was performed in SGC-7901 cells. Luciferase reporter plasmids with either the wt or mut targeting sequence of TWIST1 mRNA were created (Fig. 2A). These were co-transfected with miR-381 mimic or miR-381 NC into SGC-7901 cells, cultured for 48 h, and the luciferase activity was measured. As indicated in Fig. 2B, miR-381 significantly decreased the luciferase activity of the wt TWIST1 UTR reporter (P<0.05), while the transfection with the mut UTR of TWIST1 did not. These results demonstrated that TWIST1 was a direct target gene of miR-381.

To investigate the effect of miR-381 on GC SGC-7901 cell viability, an MTT assay was performed. To evaluate the effect of miR-381 expression, the mimic transfection assay was used. Transfection of miR-381 mimic significantly increased the expression of miR-381 compared with the miR-381 NC and mock groups (Fig. 3A). The MTT results indicated that miR-381 significantly decreased the viability of SGC-7901 cells compared with mock and miR-381 NC cells (P<0.05), while there was no significant difference between miR-381 NC and mock group (Fig. 3B). Further to these results, colony formation assays demonstrated that miR-381 expression resulted in fewer SGC-7901 cell colonies compared with mock and miR-381 NC (P<0.05; Fig. 3C). No significant differences in the number of colonies between the miR-381 NC and mock group were observed (Fig. 3C). These results revealed that miR-381 may serve an important role in GC cell viability, and that induction of miR-381 expression may inhibit GC cell proliferation.

The effect of miR-381 on GC cell invasion and migration was also verified to further characterize miR-381 in GC. The results indicated that upregulation of miR-381 affected cell migration and invasion in a Transwell chamber (Fig. 4A): Upregulation of miR-381 inhibited the migration and invasion capacity of SGC-7901 cells. The cells that successfully migrated in the miR-381 upregulation group corresponded to ~1/3 of the number of cells in the miR-381 NC group (Fig. 4B). Therefore, the data suggested that miR-381 may regulate GC growth through the inhibition of cell proliferation, migration and invasion.

TWIST1 was verified to be a direct target of miR-381, and a previous study indicated that TWIST1 regulation was associated with cell apoptosis (26). Therefore the effect of miR-381 GC cell apoptosis was evaluated. SGC-7901 cells transfected with miR-381 mimic or miR-381 NC were cultured for 48 h, harvested and stained with PI and Annexin V for an FCM assay. The results indicated that the percentage of apoptotic cells in the miR-381 mimic group was increased compared with the miR-381 NC group (P<0.05; Fig. 5), which suggests that expression of miR-381 may have enhanced GC cell apoptosis.

To investigate whether the effect of miR-381 on cell proliferation and apoptosis was caused by the regulation of TWIST1, western blotting and RT-qPCR were performed. The results indicated that the expression of TWIST1 was increased in GC cells compared with the immortalized human gastric epithelial GES cells (Fig. 6A and B). Transfection of miR-381 mimic significantly decreased the expression of TWIST1 in GC cells compared with the miR-381 NC group (P<0.05; Fig. 6A and B). RT-qPCR results also indicated that transfection of TWIST1 siRNA decreased the expression of TWIST1 (Fig. 6C). As expected, TWIST1 knockout via co-transfection of miR-381 mimics and TWIST1-siRNA also inhibited GC cell growth (Fig. 6D). Therefore, these results demonstrated that upregulation of miR-381 may inhibit SGC-7901 GC cell growth by targeting TWIST1.