Dulbecco's Modified Eagle's medium (DMEM), RPMI-1640 medium and protease inhibitor cocktails were purchased from Sigma-Aldrich; Merck KGaA. Trypsin-EDTA, PBS, penicillin/streptomycin and fetal bovine serum (FBS) were from Thermo Fisher Scientific, Inc. Antibodies (Abs) directed against GAPDH, Bcl-2, Bax, p38 mitogen-activated protein kinase (MAPK), phosphorylated (p)-p38MAPK, Akt, p-Akt, horseradish peroxidase (HRP)-coupled anti-rabbit IgG secondary Ab and lysis buffer were purchased from Cell Signaling Technology, Inc. Protein concentration was determined by bicinchoninic acid (BCA) protein assay kit from Pierce; Thermo Fisher Scientific, Inc. Immobilon Western HRP Substrate was purchased from Merck KGaA. Fluorescent assays for apoptosis was from Beijing Solarbio Science & Technology Co., Ltd. The Cell Titer 96^® AQueous One Solution Cell Proliferation Assay was obtained from Promega Corporation. miR-210 mimics, miR-210 inhibitors and negative controls (NC) of miRNA were all designed and synthesized by Sangon Biotech Co., Ltd. The sequences of miR-210 inhibitor negative controls and mimics negative controls were as follows (5′ to 3′): miR-210 inhibitor negative controls, CAGUACUUUUGUGUAGUACAA; miR-210 mimics negative controls sense, UUCUCCGAACGUGUCACGUTT; and miR-210 mimics negative controls antisense, ACGUGACACGUUCGGAGAATT. TRIzol^® and Lipofectamine^® RNAiMAX reagent were obtained from Thermo Fisher Scientific, Inc. MicroRNA reverse transcription kit was from New England BioLabs, Inc. SYBR Green PCR Master Mix was purchased from Takara Biotechnology Co., Ltd. A lipid peroxidation malondialdehyde (MDA) assay kit was purchased from Beyotime Institute of Biotechnology (cat. no. S0131).

HL-1 cells were provided by Dr William Claycomb (Louisiana State University Health Science Center), an immortalized cell line derived from mouse atrial cardiac myocytes, were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were maintained at 37°C in a humidified chamber with an atmosphere of 95% air and 5% CO₂.

When the cells reached a confluence of 60–70%, HL-1 cells were cultured in FBS-free media for 24 h before all experiments. To mimic ischemic injury in vivo, cells were exposed to ischemia-mimetic solution as previously described (19). Subsequently, the cells were incubated in a 3-gas hypoxic chamber (HERAcell VIOS 160i, Thermo Fisher Scientific, Inc.) equilibrated with 94% N₂, 5% CO₂ and 1% O₂ for 5 h.

After 5 h of hypoxia, cells were subjected to SWT as previously described (20). In brief, the HL-1 cells were digested with trypsin after hypoxia, transferred to centrifuge tubes (1 ml, 5×10⁶ cells/ml) and treated with a shock wave device (Duolith VET; Storz Medical AG). Both the ultrasonic probe and the tubes were submerged in a water bath at 37°C. Then, 200 pulses of shock waves with an energy of 0.05 mJ/mm² were administered to the cells. After SWT, cells were placed in standard medium under normoxic conditions for 12 h before harvest.

Cell viability was measured by Cell Titer 96 AQueous One Solution Cell Proliferation Assay. In brief, HL-1 cells were obtained after hypoxia and SWT treatment and re-suspended to a density of 5×10⁶ cells/ml. Then, cells were seeded in 24-well plates in quadruplicate. MTS reagent (45 µl) was added to each well of the 24-well plates with 225 µl of culture medium. After 4 h, the absorbance was detected at 490 nm using a microplate reader.

Cell apoptosis was analyzed using flow cytometry after fluorescein isothiocyanate-conjugated Annexin V (FITC-Annexin V; Beijing Solarbio Science & Technology Co., Ltd.) and propidium iodide (PI) staining. The staining procedure was performed according to the instructions. HL-1 cells in early logarithmic growth phase were seeded in 6-well plates, harvested by centrifugation at 800 g for 5 min at room temperature, and then washed twice with PBS. Cells were resuspended in 100 µl of 1X binding buffer to a density of 1×10⁶ cells/ml, 5 µl of Annexin V-FITC was added, and the cells were incubated in the dark at room temperature for 10 min. Then, 5 µl of PI was added and the cells were incubated in the dark at room temperature for another 5 min. Finally, 500 µl of 1X binding buffer was added to the mixture, which was then loaded onto a flow cytometer (FACSCalibur; BD Biosciences) for the apoptosis analysis using FlowJo 7.6.1 (BD Biosciences). Cells that were considered viable were both Annexin V and PI negative, while cells that were in early apoptosis were Annexin V positive and PI negative, and necrotic cells were both Annexin V and PI positive.

MDA is a natural byproduct of lipid peroxidation and used as a reliable marker to measure the level of oxidative stress. Free MDA reacts with thiobarbituric acid (TBA) and generates an MDA-TBA adduct, which can be quantified colorimetrically (optical density 532 nm). MDA levels were measured using the TBA method according to the manufacturer's protocol.

ROS generation was measured with dihydroethidium (DHE; Invitrogen; Thermo Fisher Scientific, Inc.) staining and observed under a fluorescent microscope (Olympus BX51; Olympus Corporation; magnification, ×50). Briefly, When the HL-1 cells reached the appropriate confluence (70–80%) in 24-well plates, the cells were incubated with DHE (8 µm) for 30 min at 37°C in the dark, and then washed with PBS. Following the manufacturer's protocols, DHE was alternately excited at a wavelength of 535 nm and emitted at a wavelength of 512 nm. The fluorescence was measured and expressed as a percentage of the integrated optical density in the control.

HL-1 cells were lysed in ice-cold lysis buffer (Cell Signaling Technology, Inc.) supplemented with phosphatase and protease inhibitors. Cell lysates were incubated on ice for 5 min and centrifuged at 13,000 g for 15 min (4°C). Protein concentrations of the supernatants were determined using a Pierce™ BCA Protein Assay Kit. All samples were boiled for 10 min at 100°C. Soluble proteins (20 µg/lane) were electrophoresed on 12% SDS polyacrylamide gels and transferred to polyvinylidene fluoride membranes that were then blocked with TBS with 0.1% Tween-20 buffer containing 5% non-fat milk for 2 h at room temperature. Membranes were incubated overnight at 4°C with specific primary Abs (1:1,000) against GAPDH (cat. no. 5174), Bcl-2 (cat. no. 2772), p38 MAPK (cat. no. 8690), p-p38 MAPK (cat. no. 4511), Akt (cat. no. 4691) and p-Akt (cat. no. 4060), and then incubated with secondary Ab (1:5,000; ct. no. 7074) for 2 h at room temperature. The immunoreaction was visualized with Immobilon Western HRP substrate. Densitometry was performed using ImageJ software Java 1.8.0 (National Institutes of Health).

Total RNAs from cardiomyocytes were isolated by TRIzol^® reagent. The concentration of RNA was detected using a NanoDrop™ 2,000 Spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). Using a microRNA reverse transcription kit (New England BioLabs, Inc.), 800 ng of total RNA was reverse transcribed. The RNA specific primers and SYBR Green were used for RT-qPCR to examine the relative quantification of RNAs with a Bio-Rad iCycler RT-PCR Detection System (Bio-Rad Laboratories, Inc.). The thermocycling conditions were: 95°C for 10 min, 95°C for 15 sec and 60°C for 60 sec. Then, steps 2–3 were repeated for 40 cycles. U6 and GAPDH were chosen as internal controls. Each reaction was performed in triplicate, and analysis was performed by the 2^−∆∆Cq method (21). The primers are shown in Table I.

HL-1 cells (70% confluent) were transfected with miR-210 mimics (20 µM) or inhibitors (20 µM) or miRNA negative controls using Lipofectamine-RNAiMAX reagent according to the manufacturer's protocols. After 24 h of transfection, cells were treated with hypoxia and SWT.

The MDC kit was obtained from Nanjing KeyGen Biotech Co., Ltd. The cells were washed twice with 300 µl 1X washing buffer. Then, 100 µl working solution was added to each well. The cells were incubated at room temperature for 20 min in the dark. The cells were washed four times with 1X washing buffer to remove redundant dye. Finally, cells were visualized using a fluorescent microscope (magnification, ×50) with an excitation wavelength of 355 nm and an emission filter of 512 nm.

Data are presented as the mean ± SEM. Student's t-test and one-way ANOVA with Bonferroni correction were performed to compare two conditions and multiple groups, respectively. All statistical calculations were performed by GraphPad Prism 5 software (GraphPad Software, Inc.) and P<0.05 was considered to indicate a statistically significant difference.

HL-1 cardiomyocytes have previously been applied in hypoxia-induced studies, and have been demonstrated as a cell line for cardiomyocyte study (22). Therefore, the present study created an in vitro model of myocardial ischemia using HL-1 cells. When using the MTS assay, cell viability was significantly decreased by 29.6±1.6% after 5 h of exposure to hypoxia, followed by 12 h of reoxygenation when compared with the control, which was considered to be a moderate injury (Fig. 1A). In order to further investigate hypoxia-induced injury in cardiomyocytes, an Annexin V/PI staining assay was used to detect cardiomyocyte apoptosis. Hypoxia significantly increased the apoptotic rate compared with normoxic cells (Fig. 1B). Furthermore, western blot analysis verified that hypoxia induced a decrease in the Bcl-2/Bax ratio, indicating an increase in cell apoptosis (Fig. 2).

In order to investigate the effect of SWT on hypoxic injury, SWT was applied to HL-1 cells during the first 10 min of reperfusion. SWT led to increased cell viability (Fig. 1A), a significant decrease in apoptosis as manifested by reduced apoptotic cells (Fig. 1B) and an elevated Bcl-2/Bax ratio specifically in hypoxic cells (Fig. 2), which was demonstrated by the morphological changes of HL1 cells and the decreased number of dead cells after SWT (Fig. S1). Accumulating evidence has suggested that excessive ROS generation during ischemia could stimulate apoptosis (23). Therefore, the present study determined whether SWT inhibited ROS production in the hypoxic model. Using DHE staining, the present study revealed increased ROS production following hypoxia treatment, and ROS levels were decreased by SWT (Fig. 3A). Excessive production of ROS results in lipid peroxidation that generates oxidized by-products, such as MDA (24). Thus, the present study detected MDA levels using the TBA method. As presented in Fig. 3B, the hypoxic challenge caused a markedly increased MDA level, which was downregulated by SWT (NC group vs. HR group vs. HR + SWT group, 1.0780±0.1229 nmol/mg protein vs. 3.5000±0.1600 nmol/mg protein vs. 2.8000±0.2300 nmol/mg protein, respectively). Furthermore, in order to determine the molecular mechanisms underlying the protective effects of SWT on hypoxic injury, cell survival-associated proteins, including p38MAPK and Akt, were measured. Western blot analysis revealed that cells exposed to hypoxia exhibited significantly decreased expression of p-Akt and significantly increased expression of p-p38MAPK (Fig. 2). In addition, it was revealed that SWT significantly suppressed hypoxia-induced p38MAPK phosphorylation and increased p-Akt in HL-1 cells. Overall, these data suggested that SWT could reverse oxidative stress and apoptosis in HL-1 cells exposed to hypoxia.

Previous reports have demonstrated that miR-210 is one of several hypoxia-induced miRNAs that may play an important role in cell survival (25). In order to investigate whether hypoxia regulated miR-210 in HL-1 cells, the present study used RT-qPCR to determine miR-210 levels in HL-1 cells following hypoxia treatment. As presented in Fig. 4A, hypoxia led to a substantial increase in miR-210 expression. Notably, the administration of SWT to the hypoxic cells resulted in a significant increase in miR-210 expression in comparison with the hypoxia group.

In order to investigate the effect of miR-210 on cardiomyocytes following hypoxia, miR-210 mimics and inhibitors were transfected in order to alter the expression of miR-210 in HL-1 cells. RT-qPCR analysis revealed that miR-210 expression in the mimics group was significantly increased compared with HL-1 cells transfected with the negative control in normoxic and hypoxic cells (Fig. 4B); in contrast, inhibitors transfection decreased miR-210 expression (Fig. 4C). Using an MTS assay, the data from the present study revealed that increased expression of miR-210 significantly increased cell viability, while inhibition of miR-210 decreased cell viability when compared with the respective controls (Fig. 4D). Consistently, oxidative stress was evaluated by MDA levels. As presented in Fig. 4E, overexpression of miR-210 led to a significant decrease in MDA level induced by hypoxia, while miR-210 inhibition resulted in the opposite effect. In order to determine whether miR-210 plays a role in regulating hypoxia-induced apoptosis in cardiomyocytes, Bax and Bcl-2 expression levels were evaluated via western blot analysis. As presented in Fig. 5, the Bcl-2/Bax ratio was significantly increased following transfection with miR-210 mimics when compared with controls, while miR-210 inhibitors decreased this level. Overall, these data demonstrated that miR-210 protected HL-1 cells against hypoxia-induced injury by inhibiting apoptosis and oxidative stress.

In order to verify whether SWT protects cardiomyocytes from hypoxia injury by regulating miR-210, HL-1 cells were transfected with miR-210 inhibitors or the negative controls prior to hypoxia treatment. The data in Fig. 6A and B demonstrated that the increased cell viability and decreased MDA levels regulated by SWT were reversed by miR-210 inhibition. Furthermore, the effects of SWT on apoptosis-associated proteins including Bax and Bcl-2 were attenuated by miR-210 inhibition (Fig. 6C). Collectively, miR-210 inhibition affected cytoprotection of SWT in hypoxia-induced injury.

Previous studies have reported that miR-210 exerts its cardioprotective action against hypoxia-induced apoptosis by regulating Casp8ap2 and AIFM3 (9,10). In the present study, RT-qPCR analysis demonstrated that miR-210 overexpression decreased the mRNA expression levels of AIFM3 and Casp8ap2, and miR-210 inhibitors increased the mRNA expression levels of AIFM3 and Casp8ap2 (Fig. S2). In order to further identify the underlying molecular mechanisms responsible for the cytoprotective effects of SWT on hypoxia-induced apoptosis in HL-1 cells, RT-qPCR was performed to detect the mRNA levels of Casp8ap2 and AIFM3. Fig. 7 demonstrates that SWT led to a significant decrease in Casp8ap2 and AIFM3 mRNA levels, which were upregulated by hypoxia.