Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2019.10871 mmr-21-02-0659 Articles Expression pattern of placenta specific 8 and keratin 20 in different types of gastrointestinal cancer HungChih-Sheng 1 WangYen-Chieh 2 3 GuoJiun-Wen 4 5 YangRuey-Neng 6 7 LeeChia-Long 1 3 ShenMing-Hung 3 8 9 HuangChi-Cheng 10 HuangChi-Jung 3 4 5 11 YangJhih-Yun 12 LiuChih-Yi 13 Department of Internal Medicine, Division of Gastroenterology, Cathay General Hospital, Taipei 10630, Taiwan, R.O.C. Department of Surgery, Division of Urology, Cathay General Hospital, Taipei 10630, Taiwan, R.O.C. School of Medicine, College of Medicine, Fu Jen Catholic University, New Taipei 24205, Taiwan, R.O.C. Department of Medical Research, Cathay General Hospital, Taipei 10630, Taiwan, R.O.C. PhD Program in Pharmaceutical Biotechnology, College of Medicine, Fu Jen Catholic University, New Taipei 24205, Taiwan, R.O.C. Department of Internal Medicine, Sijhih Cathay General Hospital, New Taipei 22174, Taiwan, R.O.C. Department of Nursing, Ching Kuo Institute of Management and Health, Keelung 20301, Taiwan, R.O.C. Department of Surgery, Fu Jen Catholic University Hospital, New Taipei 24352, Taiwan, R.O.C. PhD Program in Nutrition and Food Science, Fu Jen Catholic University, New Taipei 24205, Taiwan, R.O.C. Department of Surgery, Taipei-Veterans General Hospital, Taipei 11217, Taiwan, R.O.C. Department of Biochemistry, National Defense Medical Center, Taipei 11490, Taiwan, R.O.C. Department of Mathematics, Taipei Wego Private Senior High School, Taipei 11254, Taiwan, R.O.C. Department of Pathology, Sijhih Cathay General Hospital, New Taipei 22174, Taiwan, R.O.C. Correspondence to: Dr Chih-Yi Liu, Department of Pathology, Sijhih Cathay General Hospital, 2 Lane 59, Jiancheng Road, New Taipei 22174, Taiwan, R.O.C., E-mail: cyl1124@gmail.com 022020 06122019 21 2 659 666 22022019 06112019 Copyright: © Hung et al. 2020 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

The aim of the present study was to investigate the expression of keratin 20 (KRT20) and placenta specific 8 (PLAC8) in gastrointestinal (GI) cancer with various differentiation phenotypes. The present study retrospectively investigated archived formalin-fixed paraffin-embedded tissue samples from 12 patients at different stages of GI cancer [four with gastric cancer, four with pancreatic cancer and four with colorectal cancer (CRC)]. The stages were pre-determined, according to differentiation phenotypes, by a pathologist of the Department of Pathology at Sijhih Cathay General Hospital. KRT20 and PLAC8 expression levels were assessed using immunohistochemistry. The CRC cell lines SW620 and Caco-2 were used to assess interactions between KRT20 and PLAC8 via reverse transcription-quantitative PCR. PLAC8 and KRT20 expression was observed consistently only in the well-differentiated CRC tissue samples. Low KRT20 expression levels were observed in the PLAC8 knockdown SW620 cells. In addition, there was a positive association between PLAC8 and KRT20 expression in the differentiated Caco-2 cells. According to the results of the present study, the differentiation status of GI cancer influenced KRT20 expression, particularly in CRC, which may explain why patients with well-differentiated CRC display better clinical outcomes. Therefore, the prognostic significance of KRT20 and PLAC8 may be particularly crucial for patients with CRC displaying a well-differentiated phenotype.

 gastrointestinal cancer keratin 20 placenta specific 8 poorly differentiated well differentiated Introduction

Gastrointestinal (GI) cancer develops in the organs of the alimentary canal, including the esophagus, liver and bile ducts, gallbladder, pancreas, stomach and small and large intestines (1). Although some distinct mutations have been reported in different GI organs, GI tumors display several key molecular alterations (2,3).

Keratins (KRTs) are a family of fibrous structural proteins that are present in normal epithelia, however, some are upregulated in neoplasms (4). The differential expression of KRTs facilitates the diagnosis of several tumors, including GI tumors, using molecular techniques and allows KRTs to be used as biomarkers to discriminate primary from metastatic adenocarcinoma (5–8). In addition, KRTs have long been considered epithelial differentiation markers (9) and the differentiation of cells within the GI tract is associated with an increased susceptibility to GI cancer (10,11).

In addition to being involved in conventional tumorigenesis, epithelial-mesenchymal transition (EMT) plays key roles in cellular differentiation and cancer progression (12,13). KRTs have been reported to be aberrant in cells undergoing EMT (14,15). For example, the detection of KRT20-positive circulating tumor cells is associated with worse prognosis in patients with colorectal cancer (CRC) (16). In addition to structural KRTs, other genes often exhibit dysregulated expression during EMT. Previously, placenta specific 8 (PLAC8), a gene expressed under physiological conditions, was reported to play a key role in the tumorigenic and EMT pathways in a number of types of human cancer, such as CRC or pancreatic cancer (CaP) (17,18). PLAC8 was expressed at high levels in the GI tract and KRT20 expression patterns were highly specific (19–21). In addition, elevated PLAC8 levels are positively associated with tumor metastasis and recurrence in CRC (18,22). Understanding the interaction between KRT20 and PLAC8 could have clinical implications for the treatment of GI cancer. In the present study, immunostaining was employed to detect the expression of KRT20 and PLAC8 in the tissues of patients with GI cancer [gastric cancer (GC), CaP and CRC]. Furthermore, the mRNA levels of KRT20 in CRC cells displaying differential PLAC8 expression were quantified.

 Materials and methods <sec> <title>Tissues and cell lines

Archived 4 µm formalin-fixed paraffin-embedded (FFPE) tissue sections from four GC, four CaP and four CRC patients who had undergone surgery at the Department of Surgery of Cathay General Hospital before December, 2000 were obtained and used in the present study. All procedures were approved by the Cathay General Hospital Institutional Ethics Committee and a waiver of consent was approved by the same committee. Patient information was anonymized.

For each cancer (GC, CaP and CRC), two patients had well-differentiated cancer [one at American Joint Committee on Cancer (AJCC) stage II and one at stage III] and two had poorly differentiated cancer (one at AJCC stage II and one at stage III) (23). Cancer diagnoses were performed by a pathologist. The human CRC cell lines SW620 [cat. no. CRL-1831; AJCC stage III) and Caco-2 (cat. no. HTB-37) were obtained from the American Type Culture Collection (ATCC) and the medium suggested by the ATCC for each cell line was used for culture; Leibovitz's L-15 medium for SW620 cells and the Eagle's Minimum Essential medium for Caco-2 cells. The two CRC cell lines were selected due to their high PLAC8 expression levels (SW620 cells) (24) and their differentiation capacity (Caco-2 cells) (25). SW620 cells were incubated at 37°C and 100% air (with very low CO2) in a humidified incubator and subcultured 2 to 3 times per week (25). To induce intestinal differentiation, Caco-2 cells were cultured to confluence in a humidified incubator at 37°C with 5% CO2 for 21 days, as described in a previous study (25).

 PLAC8 knockdown and detection of PLAC8 mRNA level in CRC cells

PLAC8 mRNA levels were knocked down in SW620 cells using a lentivirus-mediated small hairpin (sh) RNA targeting PLAC8 to obtain shPLAC8-SW620 cells. Control (shLUC-SW620) cells were obtained using a lentivirus-mediated shRNA targeting luciferase (25). The lentiviruses and the protocol for lentivirus infection were acquired from the National RNAi Core Facility of Academia Sinica. Briefly, 1×106 SW620 cells were grown in a 10 cm plate for 24 h, and then infected with lentivirus at a multiplicity of infection of 3. Stable infected cells were selected and maintained in medium containing 2 µg/ml puromycin for 48 h (Thermo Fisher Scientific, Inc.). The total RNA of the transfected cells was then extracted using RNAzol® RT (Molecular Research Center) and reverse transcribed into cDNA using a high-capacity cDNA Reverse Transcription kit (Catalog No. 4368813; Thermo Fisher Scientific, Inc.) in the presence of oligo(dT) primers, according to the manufacturer's instructions. The level of mRNA was considered as the gene expression level and was measured by PCR in the presence of specific amplification primers (Table I), a TaqMan probe and TaqMan master mix (Roche Diagnostics GmbH), according to the manufacturer's instructions. Cycling conditions were: 2 min at 50°C and 10 min at 95°C, followed by 50 cycles each consisting of 15 sec at 95°C and 1 min at 60°C. mRNA levels were adjusted relative to the level of GAPDH to estimate the relative levels of gene expression with the method of the 2−ΔΔCq method (26). LightCycler (version 4.05; Roche Diagnostics GmbH) was used to analyze the PCR kinetics.

 Immunohistochemical staining of PLAC8 and KRT20 in the archived FFPE tissue sections

For the PLAC8 immunohistochemical staining, a VECTASTAIN® Elite ABC kit (Vector Laboratories, Inc.) was used according to the manufacturer's instructions. Briefly, cancer tissue sections were incubated in oven at 65°C for 30 min to deparaffinize, and then each tissue was rehydrated with 100, 90 and 70% ethanol, sequentially. The rehydrated slides were immersed in citrate buffer (10 mM; pH 6.0), boiled (95–99°C) for 20 min and then cooled to room temperature for 20 min. To inactivate endogenous peroxidases within the tissues, the slides were incubated for 30 min at room temperature in 3% methanolic hydrogen peroxide. The tissue sections were then blocked for 30 min at room temperature using a blocking solution with 5% rabbit serum (Vector Laboratories, Inc.) and incubated overnight at 4°C with anti-PLAC8 antibody (1:200; cat. no. ab122652; Abcam) or anti-KRT20 antibody (1:200; cat. no. ab76126; Abcam). After washing the tissues several times with Tris-buffered saline, the samples were incubated with a secondary biotinylated goat anti-rabbit IgG antibody (1:200; cat. no. BA-1000; Vector Laboratories) for 1 h at room temperature. Subsequently, the slides were stained with 3-amino-9-ethylcarbazole (DAKO; Agilent Technologies, Inc.) for 1 min at room temperature to visualize PLAC8 and KRT20. Tissues were stained with hematoxylin for 4 min and then with eosin for another 1.5 min at room temperature for identification of normal and tumor areas. The stained sections were subsequently diagnosed by a pathologist via a light microscope Olympus BX41 with magnification at ×200 (Olympus Corp.). Then, the GI cancer tissue sections were divided into two differentiation states (well or moderately differentiated, >50% glandular formation and poorly differentiated, 0–49% glandular formation) (27).

 Statistical analysis

Data were presented as mean ± standard deviation. The relative expression levels of PLAC8 and KRT20 in cells were compared between samples using the Student's t-test. All statistical analyses were performed using SPSS (version 19; IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>PLAC8 and KRT20 expression in well-differentiated GI stage II and III cancer cells

Cellular KRT20 and PLAC8 proteins were detected in each of the cancer tissues using immunohistochemistry. In the well-differentiated GC cancer tissues, PLAC8 levels were low and tissues were KRT20-positive regardless of tumor stage (Fig. 1). Conversely, tissues were positive for both PLAC8 and KRT20 in the well-differentiated CaP tissues at stages II and III, but PLAC8 displayed a luminal staining pattern (Fig. 2). In addition to the expression patterns in the well-differentiated GC and CaP cases, the expression patterns of PLAC8 and KRT20 were also immunodetected in well-differentiated CRC cases (Fig. 3). PLAC8 signals were consistently low in the well-differentiated CRC at stage II (the left panel of Fig. 3), but the small number of PLAC8-positive CRC cells appeared to also express KRT20. Furthermore, a co-expression of PLAC8 and KRT20 was observed in the well-differentiated CRC cells at stage III (the right panel of Fig. 3).

 PLAC8 and KRT20 expression in the poorly differentiated GI cancer cells at stages II and III

Immunohistochemical staining revealed that although poorly differentiated GC tissues expressed similar levels of PLAC8 at stage II and III (the middle panel of Fig. 4), these tissues expressed higher levels of KRT20 at stage III compared to stage II (the bottom panel of Fig. 4). Conversely, the poorly differentiated CaP at stage II displayed higher levels of PLAC8 compared with the CaP tissues at stage III, and KRT20 levels were low in the poorly differentiated CaP at both stage II and III (Fig. 5). The PLAC8 and KRT20 expression patterns in poorly differentiated CRC were different from those in well-differentiated CRC (Fig. 6). PLAC8 expression was higher in the poorly differentiated CRC tissue at stage III than at stage II (the middle panel of Fig. 6). However, the late tumor stage (stage III) did not appear to increase the expression of KRT20 in the poorly differentiated CRC tissue.

 PLAC8 and KRT20 expression levels in transfected and differentiated CRC cell lines

PLAC8 expression was knocked down in SW620 cells, displayed by an 80% decrease in PLAC8 mRNA levels (shPLAC8-SW620) compared with the levels in the control cells (shLUC-SW620; Fig. 7A). The KRT20 mRNA levels in the shPLAC8-SW620 cells also decreased by 76% compared with the levels in the control cells (Fig. 7A). The mRNA levels of both PLAC8 and KRT20 in the differentiated Caco-2 cells (day 21) decreased by 72 and 85%, respectively, compared with the levels in the day 1 Caco-2 cells (Fig. 7B).

 Discussion

In clinical settings, patients with different types of GI cancer should be diagnosed using appropriate biomarkers, even though gut-derived adenocarcinomas display similar genetic alterations (28–32). Lukyanchuk et al (33) reported that KRT20 had clinical significance in GI cancer, including GC, CaP and CRC. Thus, the present study focused on investigating KRT20 and PLAC8 expression in these types of GI cancer. In the present study, the aberrant co-expression of the cytoplasmic protein PLAC8 and the cytokeratin KRT20 were found in the well-differentiated CRC at stage III, but this expression pattern was not observed in poorly differentiated CRC. No such co-expression was observed in the GC and CaP tissue sections, regardless of tumor stage and differentiation state. CRC tissues at stages II and III have been frequently studied to improve prognosis and to avoid the incorrect use of chemotherapeutic agents (34,35).

Cytoskeletal rearrangement is required for cell migration and invasion, which are key steps in cancer metastasis (36,37). Highly dynamic biological processes of cytoskeletal organization in cancer have been extensively explored (38–42). Among the different cytoskeletal molecules, KRTs might be the most examined based on clinical significance (43,44), and several KRTs have been previously studied from a tumor progression perspective (45–47). For example, previous studies have reported that upregulation of KRT17 and KRT19 may be involved in tumor metastasis (5,48) and that KRT18 and KRT19 are associated with colorectal malignancy (49–52). In addition, aberrant KRT20 expression has been observed in generalized GI cancer (16,19,53) and is recognized as a marker of circulating CRC cells (54). Therefore, KRT20 could be a suitable marker for the evaluation of the primary origin of GI cancer, including CRC (19,55).

PLAC8, a novel oncogenic marker that mediates tumor progression, has also been reported to play a key role in the EMT of CRC (18,22). In the present study, an association between KRT20 and PLAC8 expression was observed in CRC cells. The KRT20 mRNA levels decreased in the PLAC8-knockdown SW620 CRC cells, which were diagnosed as AJCC stage III. In addition, the intestinal differentiation of Caco-2 cells was used to evaluate the well-differentiated state of GI cancer (56,57). Such spontaneously differentiated Caco-2 cells displayed decreasing levels of KRT20 and PLAC8 expression upon differentiation. The Caco-2 cell line, which is applied extensively as an intestinal epithelial barrier model, displays favorable differentiation in a continuous culture (58,59). In addition, the positive association between KRT20 and PLAC8 expression levels in the well-differentiated CRC was confirmed by immunostaining of archived FFPE tissue sections. The FFPE tissue sections of other well-differentiated GI cancer (GC and CaP) at stages II and III did not display patterns similar to those of CRC and no association between PLAC8 and KRT20 expression levels were observed in the three poorly differentiated GI cancer tissues (GC, CaP and CRC). The results from the present study suggested that understanding the expression of PLAC8 and KRT20 could be critical for predicting the prognosis of patients with CRC.

Experiments exploring the molecular heterogeneity of CRC could facilitate the formulation of effective therapies (60,61). CRC development and progression is a complex process involving multiple genetic changes (62–64). The genes involved in CRC tumorigenesis should therefore be identified for clinical applications (65). Chemotherapy, target molecule therapy (with vascular endothelial growth factor or epidermal growth factor receptor) and immunotherapy (anti-programmed death-1) lead to increased survival rates and decreased recurrence rates in CRC (66–68). Imai et al (69) revealed that the KRT20 expression was closely associated with the invasive histological phenotype in poorly differentiated colorectal adenocarcinoma. However, in the present study, it was suggested that the differentiation status of GI cancer may influence KRT20 expression, particularly in CRC.

A recent animal study reported that PLAC8 expression might be associated with the gut microbiota (70) and others detected that aberrant KRT20 expression is induced by altering the gut microbiota (71). Taken together, these results implied that KRT20 and PLAC8 might work cooperatively in different types of GI cancer. The present study suggested that PLAC8 expression could influence KRT20 expression. Therefore, it could be hypothesized that a well-differentiated CRC may have poor prognosis if KRT20 is induced via the upregulation of PLAC8. Conversely, the downregulation of PLAC8 may reduce the expression levels of KRT20. These suggested molecular dynamics imply that RNA interference of PLAC8 expression could be used as a therapeutic technique for the treatment of GI cancer at stages II and III. A similar concept that uses small interfering RNA as a cancer therapeutic agent has been explored extensively (72–74). In addition, PLAC8 promotes tumor growth, invasion and metastasis in other tumors, which could explain why patients with well-differentiated CRC display different clinical outcomes, in comparison with the patients with poorly-differentiated CRC (17,22,75,76). Therefore, the prognostic significance of KRT20 and PLAC8 could be particularly essential for patients with CRC displaying well-differentiated phenotypes.

 Acknowledgements

Not applicable.

 Funding

The present study was supported by the fund (grant no. 2018 to Chi-Jung Huang) from The Department of Medical Research of Cathay General Hospital.

 Availability of data and materials

All data generated or analyzed during this study are included in this published article.

 Authors' contributions

CSH, YCW and CYL designed the study. CSH and CYL wrote the initial version of the manuscript. JWG and CCH performed the cell studies. JWG, JYY and CYL performed the immunostaining and pathologic diagnosis. RNY, CLL, MHS and CCH interpreted the patient data regarding the well-differentiated and poorly-differentiated CRC. CCH and CJH performed the statistical analyses. CYL provided supervision throughout the study. All authors discussed, modified and approved of the final version.

 Ethics approval and consent to participate

All procedures were approved by The Cathay General Hospital Institutional Ethics Committee and a waiver of consent was approved by the same committee.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References KeighleyMRGastrointestinal cancers in europeAliment Pharmacol Ther18730200310.1046/j.0953-0673.2003.01722.x14531737 LiuYSethiNSHinoueTSchneiderBGCherniackADSanchez-VegaFSeoaneJAFarshidfarFBowlbyRIslamMComparative molecular analysis of gastrointestinal adenocarcinomasCancer Cell33721735201810.1016/j.ccell.2018.03.010296224665966039 VedeldHMAndresenKEilertsenIANesbakkenASerucaRGladhaugIPThiis-EvensenERognumTOBobergKMLindGEThe novel colorectal cancer biomarkers CDO1, ZSCAN18 and ZNF331 are frequently methylated across gastrointestinal cancersInt J Cancer136844853201510.1002/ijc.2903924948044 MollRLevyRCzernobilskyBHohlweg-MajertPDallenbach-HellwegGFrankeWWCytokeratins of normal epithelia and some neoplasms of the female genital tractLab Invest4959961019836195450 KimHSLeeJJDoSIKimKDoIGKimDHChaeSWSohnJHOverexpression of cytokeratin 17 is associated with the development of papillary thyroid carcinoma and the presence of lymph node metastasisInt J Clin Exp Pathol8569557012015261912834503154 OsbornMvan LessenGWeberKKloppelGAltmannsbergerMDifferential diagnosis of gastrointestinal carcinomas by using monoclonal antibodies specific for individual keratin polypeptidesLab Invest5549750419862429069 TangKDKennyLPerryCFrazerIPunyadeeraCThe overexpression of salivary cytokeratins as potential diagnostic biomarkers in head and neck squamous cell carcinomasOncotarget872272722802017290697865641129 TotTCytokeratins 20 and 7 as biomarkers: Usefulness in discriminating primary from metastatic adenocarcinomaEur J Cancer38758763200210.1016/S0959-8049(02)00008-411937308 FuchsEKeratins as biochemical markers of epithelial differentiationTrends Genet4277281198810.1016/0168-9525(88)90169-22474874 LipkinMBiomarkers of increased susceptibility to gastrointestinal cancer: New application to studies of cancer prevention in human subjectsCancer Res4823524519883275494 MillsJCSansomOJReserve stem cells: Differentiated cells reprogram to fuel repair, metaplasia, and neoplasia in the adult gastrointestinal tractSci Signal8re8201510.1126/scisignal.aaa7540261754944858190 KalluriRWeinbergRAThe basics of epithelial-mesenchymal transitionJ Clin Invest11914201428200910.1172/JCI39104194878182689101 ChenTYouYJiangHWangZZEpithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesisJ Cell Physiol23232613272201710.1002/jcp.25797280792535507753 ZouXZLiuTGongZCHuCPZhangZMicroRNAs-Mediated epithelial-mesenchymal transition in fibrotic diseasesEur J Pharmacol796190206201710.1016/j.ejphar.2016.12.00327916556 SerranoMJOrtegaFGAlvarez-CuberoMJNadalRSanchez-RoviraPSalidoMRodriguezMGarcia-PucheJLDelgado-RodriguezMSoleFEMT and EGFR in CTCs cytokeratin negative non-metastatic breast cancerOncotarget574867497201410.18632/oncotarget.2217252771874202138 HinzSHendricksAWittigASchafmayerCTepelJKalthoffHBeckerTRoderCDetection of circulating tumor cells with CK20 RT-PCR is an independent negative prognostic marker in colon cancer patients-a prospective studyBMC Cancer1753201710.1186/s12885-016-3035-1280868345237158 ChangWLLiuYWDangYLJiangXXXuHHuangXWangYLWangHZhuCXueLQPLAC8, a new marker for human interstitial extravillous trophoblast cells, promotes their invasion and migrationDevelopment145dev148932201810.1242/dev.148932293615555825838 LiCMaHWangYCaoZGraves-DealRPowellAEStarchenkoAAyersGDWashingtonMKKamathVExcess PLAC8 promotes an unconventional ERK2-dependent EMT in colon cancerJ Clin Invest12421722187201410.1172/JCI71103246914424001536 MiettinenMKeratin 20: Immunohistochemical marker for gastrointestinal, urothelial, and merkel cell carcinomasMod Pathol838438819957567935 MollRDivoMLangbeinLThe human keratins: Biology and pathologyHistochem Cell Biol129705733200810.1007/s00418-008-0435-6184613492386534 RogulskiKLiYRothermundKPuLWatkinsSYiFProchownikEVOnzin, a c-Myc-repressed target, promotes survival and transformation by modulating the Akt-Mdm2-p53 pathwayOncogene2475247541200510.1038/sj.onc.120889716170375 JiaYYingXZhouJChenYLuoXXieSWangQCHuWWangLThe novel KLF4/PLAC8 signaling pathway regulates lung cancer growthCell Death Dis9603201810.1038/s41419-018-0580-3297895345964121 AminMBGreeneFLEdgeSBComptonCCGershenwaldJEBrooklandRKMeyerLGressDMByrdDRWinchesterDPThe eighth edition AJCC cancer staging manual: Continuing to build a bridge from a population-based to a more ‘personalized’ approach to cancer stagingCA Cancer J Clin679399201710.3322/caac.2138828094848 LeeCLHuangCJYangSHChangCCHuangCCChienCCYangRNDiscovery of genes from feces correlated with colorectal cancer progressionOncol Lett1233783384201610.3892/ol.2016.5069279000085103954 HuangCJLeeCLYangSHChienCCHuangCCYangRNChangCCUpregulation of the growth arrest-specific-2 in recurrent colorectal cancers, and its susceptibility to chemotherapy in a model cell systemBiochim Biophys Acta186213451353201610.1016/j.bbadis.2016.04.01027085973 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 WashingtonMKBerlinJBrantonPBurgartLJCarterDKFitzgibbonsPLHallingKFrankelWJessupJKakarSProtocol for the examination of specimens from patients with primary carcinoma of the colon and rectumArch Pathol Lab Med133153915512009197920432901838 DuffyMJLamerzRHaglundCNicoliniAKalousovaMHolubecLSturgeonCTumor markers in colorectal cancer, gastric cancer and gastrointestinal stromal cancers: European group on tumor markers 2014 guidelines updateInt J Cancer13425132522201410.1002/ijc.2838423852704 Dolscheid-PommerichRCManekellerSWalgenbach- BrunagelGKalffJCHartmannGWagnerBSHoldenriederSClinical performance of CEA, CA19-9, CA15-3, CA125 and AFP in gastrointestinal cancer using LOCI-based assaysAnticancer Res37353359201710.21873/anticanres.1132928011514 KumarYTapuriaNKirmaniNDavidsonBRTumour M2-pyruvate kinase: A gastrointestinal cancer markerEur J Gastroenterol Hepatol19265276200710.1097/MEG.0b013e3280102f7817301655 MyllykangasSBohlingTKnuutilaSSpecificity, selection and significance of gene amplifications in cancerSemin Cancer Biol174255200710.1016/j.semcancer.2006.10.00517161620 MyllykangasSHimbergJBohlingTNagyBHollmenJKnuutilaSDNA copy number amplification profiling of human neoplasmsOncogene2573247332200610.1038/sj.onc.120971716751803 LukyanchukVVFriessHKleeffJOsinskySPAyuniECandinasDRoggoADetection of circulating tumor cells by cytokeratin 20 and prostate stem cell antigen RT-PCR in blood of patients with gastrointestinal cancersAnticancer Res2327112716200312894563 DalerbaPSahooDPaikSGuoXYothersGSongNWilcox-FogelNForgoERajendranPSMirandaSPCDX2 as a prognostic biomarker in stage II and stage III colon cancerN Engl J Med374211222201610.1056/NEJMoa1506597267898704784450 PilatiCTaiebJBalogounRMarisaLde ReyniesALaurent-PuigPCDX2 prognostic value in stage II/III resected colon cancer is related to CMS classificationAnn Oncol2810321035201710.1093/annonc/mdx06628328000 SinghRKapurNMirHSinghNLillardJWJrSinghSCXCR6-CXCL16 axis promotes prostate cancer by mediating cytoskeleton rearrangement via Ezrin activation and alphavbeta3 integrin clusteringOncotarget773437353201610.18632/oncotarget.6944267991864872790 WuKZhangXLiFXiaoDHouYZhuSLiuDYeXYeMYangJFrequent alterations in cytoskeleton remodelling genes in primary and metastatic lung adenocarcinomasNat Commun610131201510.1038/ncomms10131266477284682110 ChenNPUddinBVoitRSchiebelEHuman phosphatase CDC14A is recruited to the cell leading edge to regulate cell migration and adhesionProc Natl Acad Sci USA113990995201610.1073/pnas.151560511326747605 ZhouHZhangYChenQLinYAKT and JNK signaling pathways increase the metastatic potential of colorectal cancer cells by altering transgelin expressionDig Dis Sci6110911097201610.1007/s10620-015-3985-126694173 MillsKMBrocardoMGHendersonBRAPC binds the Miro/Milton motor complex to stimulate transport of mitochondria to the plasma membraneMol Biol Cell27466482201610.1091/mbc.e15-09-0632266586124751598 IvanovskaJZlobecIForsterSKaramitopoulouEDawsonHKoelzerVHAgaimyAGarreisFSoderSLaquaWDAPK loss in colon cancer tumor buds: Implications for migration capacity of disseminating tumor cellsOncotarget63677436788201510.18632/oncotarget.4908264051754742210 ZengYXieHQiaoYWangJZhuXHeGLiYRenXWangFLiangLDingYFormin-Like2 regulates Rho/ROCK pathway to promote actin assembly and cell invasion of colorectal cancerCancer Sci10613851393201510.1111/cas.12768262586424638017 AsfahaSHayakawaYMuleyAStokesSGrahamTAEricksenREWestphalenCBvon BurstinJMastracciTLWorthleyDLKrt19(+)/Lgr5(−) cells are radioresistant cancer-initiating stem cells in the colon and intestineCell Stem Cell16627638201510.1016/j.stem.2015.04.013260467624457942 LiWXXiaoHWHongXQNiuWXPredictive value of CK20 in evaluating the efficacy of treatment and prognosis after surgery for colorectal cancerGenet Mol Res1458235829201510.4238/2015.May.29.1426125781 SaadRSIsmiilNDubeVNofech-MozesSKhalifaMACDX-2 expression is a common event in primary intestinal-type endocervical adenocarcinomaAm J Clin Pathol132531538200910.1309/AJCP7E5ASGOENPFP19762530 BluemkeKBilkenrothUMeyeAFuesselSLautenschlaegerCGoebelSMelchiorAHeynemannHFornaraPTaubertHDetection of circulating tumor cells in peripheral blood of patients with renal cell carcinoma correlates with prognosisCancer Epidemiol Biomarkers Prev1821902194200910.1158/1055-9965.EPI-08-117819661076 MizuuchiESembaSKodamaYYokozakiHDown-modulation of keratin 8 phosphorylation levels by PRL-3 contributes to colorectal carcinoma progressionInt J Cancer12418021810200910.1002/ijc.2411119115206 DingSJLiYTanYXJiangMRTianBLiuYKShaoXXYeSLWuJRZengRFrom proteomic analysis to clinical significance: Overexpression of cytokeratin 19 correlates with hepatocellular carcinoma metastasisMol Cell Proteomics37381200410.1074/mcp.M300094-MCP20014593079 HammoudiASongFReedKRJenkinsREMenielVSWatsonAJPritchardDMClarkeARJenkinsJRProteomic profiling of a mouse model of acute intestinal apc deletion leads to identification of potential novel biomarkers of human colorectal cancer (CRC)Biochem Biophys Res Commun440364370201310.1016/j.bbrc.2013.08.07623998936 YangSHHuangCJLeeCLLiuCCChienCCChenSHFecal RNA detection of cytokeratin 19 and ribosomal protein L19 for colorectal cancerHepatogastroenterology57710715201021033215 YangRNYangSHChangCCChienCCPanSHuangCJUpregulation of fecal cytokeratin 19 is associated with prognosis in older colorectal cancer patientsGenet Test Mol Biomarkers14703708201010.1089/gtmb.2010.004720854102 ChangCCYangSHChienCCChenSHPanSLeeCLLinCMSunHLHuangCCWuYYClinical meaning of age-related expression of fecal cytokeratin 19 in colorectal malignancyBMC Cancer9376200910.1186/1471-2407-9-376198498442776602 KendeAICarrNJSobinLHExpression of cytokeratins 7 and 20 in carcinomas of the gastrointestinal tractHistopathology42137140200310.1046/j.1365-2559.2003.01545.x12558745 SamijaILukacJMubrinMKKiracIKovacevicDKusicZDetection of cytokeratin-20-positive cells in preoperative and postoperative blood samples from colorectal cancer patients by real-time RT-PCRInt J Biol Markers28174181201310.5301/jbm.500000323558939 KojimaSSakamotoTNagaiYHondaMOgawaFMetachronous rectal metastasis from primary transverse colon cancer: A case reportSurg Case Rep490201810.1186/s40792-018-0498-0300946966085214 ReisherSRHughesTEOrdovasJMSchaeferEJFeinsteinSIIncreased expression of apolipoprotein genes accompanies differentiation in the intestinal cell line Caco-2Proc Natl Acad Sci USA9057575761199310.1073/pnas.90.12.57578516325 FerruzzaSRossiCScarinoMLSambuyYA protocol for differentiation of human intestinal Caco-2 cells in asymmetric serum-containing mediumToxicol In Vitro2612521255201210.1016/j.tiv.2012.01.00822265977 MeunierVBourrieMBergerYFabreGThe human intestinal epithelial cell line Caco-2; pharmacological and pharmacokinetic applicationsCell Biol Toxicol11187194199510.1007/BF007565228564649 BuhrkeTLenglerILampenAAnalysis of proteomic changes induced upon cellular differentiation of the human intestinal cell line Caco-2Dev Growth Differ53411426201110.1111/j.1440-169X.2011.01258.x21492153 AllegraCSargentDMolecular diagnostics: Assays, tissues, progress, and pitfallsJ Clin Oncol21395396200310.1200/JCO.2003.11.07312560423 BustinSADorudiSGene expression profiling for molecular staging and prognosis prediction in colorectal cancerExpert Rev Mol Diagn4599607200410.1586/14737159.4.5.59915347254 BardelliAVelculescuVEMutational analysis of gene families in human cancerCurr Opin Genet Dev15512200510.1016/j.gde.2004.12.00915661527 RozenPCancer of the gastrointestinal tract: Early detection or early prevention?Eur J Cancer Prev137175200410.1097/00008469-200402000-0001115075791 VogelsteinBFearonERHamiltonSRKernSEPreisingerACLeppertMNakamuraYWhiteRSmitsAMBosJLGenetic alterations during colorectal-tumor developmentN Engl J Med319525532198810.1056/NEJM1988090131909012841597 CenterMMJemalASmithRAWardEWorldwide variations in colorectal cancerCA Cancer J Clin59366378200910.3322/caac.2003819897840 LeDTUramJNWangHBartlettBRKemberlingHEyringADSkoraADLuberBSAzadNSLaheruDPD-1 blockade in tumors with mismatch-repair deficiencyN Engl J Med37225092520201510.1056/NEJMoa1500596260282554481136 CunninghamDHumbletYSienaSKhayatDBleibergHSantoroABetsDMueserMHarstrickAVerslypeCCetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancerN Engl J Med351337345200410.1056/NEJMoa03302515269313 HurwitzHFehrenbacherLNovotnyWCartwrightTHainsworthJHeimWBerlinJBaronAGriffingSHolmgrenEBevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancerN Engl J Med35023352342200410.1056/NEJMoa03269115175435 ImaiYYamagishiHFukudaKOkamuraTOnoYBanSInoueTUedaYExpression of cytokeratin 20 indicates invasive histological phenotype in poorly differentiated colorectal adenocarcinomaAnticancer Res34159167201424403457 BarrTSureshchandraSRueggerPZhangJMaWBornemanJGrantKMessaoudiIConcurrent gut transcriptome and microbiota profiling following chronic ethanol consumption in nonhuman primatesGut Microbes93383562018295179446219653 TurroniSVitaliBCandelaMGionchettiPRizzelloFCampieriMBrigidiPAntibiotics and probiotics in chronic pouchitis: A comparative proteomic approachWorld J Gastroenterol1630412010200394462799914 SinghATrivediPJainNKAdvances in siRNA delivery in cancer therapyArtif Cells Nanomed Biotechnol46274283201810.1080/21691401.2017.130721028423924 DasMMusettiSHuangLRNA interference-based cancer drugs: The roadblocks, and the ‘Delivery’ of the promiseNucleic Acid Ther296166201910.1089/nat.2018.076230562145 ZhengMTaoWZouYFarokhzadOCShiBNanotechnology-based strategies for siRNA brain delivery for disease therapyTrends Biotechnol36562575201810.1016/j.tibtech.2018.01.00629422412 BukholmIRBondiJWiikPNeslandJMAndersenSNBakkaABukholmGPresence of isolated tumour cells in mesenteric lymph nodes predicts poor prognosis in patients with stage II colon cancerEur J Surg Oncol29862866200310.1016/j.ejso.2003.09.00714624779 ZhangYHuQLiGLiLLiangSZhangYLiuJFanZLiLZhouBONZIN upregulation by mutant p53 contributes to osteosarcoma metastasis through the CXCL5-MAPK signaling pathwayCell Physiol Biochem4810991111201810.1159/00049197630041188

Representative immunohistochemical staining for PLAC8 and KRT20 expression in well differentiated stage II and III gastric cancer tissue. Scale bar displayed in bottom right corner, magnification, ×200. H&E, hematoxylin and eosin staining; PLAC8, placenta specific 8; KRT20, keratin 20.

Representative immunohistochemical staining for PLAC8 and KRT20 expression in well differentiated stage II and III pancreatic cancer tissue. Scale bar displayed in bottom right corner, magnification, ×200. H&E, hematoxylin and eosin staining; PLAC8, placenta specific 8; KRT20, keratin 20.

Representative immunohistochemical staining for PLAC8 and KRT20 expression in well differentiated stage II and III colorectal cancer tissue. Scale bar displayed in bottom right corner, magnification, ×200. H&E, hematoxylin and eosin staining; PLAC8, placenta specific 8; KRT20, keratin 20.

Representative immunohistochemical staining for PLAC8 and KRT20 expression in poorly differentiated stage II and III gastric cancer tissue. Scale bar displayed in bottom right corner, magnification, ×200. H&E, hematoxylin and eosin staining; PLAC8, placenta specific 8; KRT20, keratin 20.

Representative immunohistochemical staining for PLAC8 and KRT20 expression in poorly differentiated stage II and III pancreatic cancer tissue. Scale bar displayed in bottom right corner, magnification, ×200. H&E, hematoxylin and eosin staining; PLAC8, placenta specific 8; KRT20, keratin 20.

Representative immunohistochemical staining for PLAC8 and KRT20 expression in poorly differentiated stage II and III colorectal cancer tissue. Scale bar displayed in bottom right corner, magnification, ×200. H&E, hematoxylin and eosin staining; PLAC8, placenta specific 8; KRT20, keratin 20.

Expression patterns of PLAC8 and KRT20 in CRC cell lines. (A) Relative gene expression of PLAC8 and KRT20 in transfected SW620 cells. SW620 cells were cultured in a humidified and CO2-free incubator. (B) Relative gene expression of PLAC8 and KRT20 in Caco-2 cells. Caco-2 cells were differentiated in a humidified incubator with 5% CO2 for 21 days. Data were presented as mean ± standard deviation and compared between samples using the Student's t-test, **P<0.01. PLAC8, placenta specific 8; KRT20, keratin 20. CRC, colorectal cancer; sh, short hairpin.

Quantitative PCR primers.

Primers (5′ → 3′)
Gene Forward Reverse
PLAC8 CGTCGCAATGAGGACTCTCT CTCTTGATTTGGCAAAGAGTACAA
KRT20 CAGTCCCATCTCAGCATGAA ACAGCGACTGGAGGTTGG
GAPDH CTCTGCTCCTCCTGTTCGAC ACGACCAAATCCGTTGACTC

PLAC8, placenta specific 8; KRT20, keratin 20.