Epithelial-to-mesenchymal transition (EMT) is a major process involved in tumor progression and metastasis. Melatonin is secreted by the pineal gland and has been documented as a potential therapeutic agent for multiple tumors. However, the effects of melatonin on EMT during osteosarcoma (OA) development remain undefined. The present study explored the biological functions and effects of melatonin on EMT induced by transforming growth factor β1 (TGF-β1) and its underlying mechanisms in MG-63 cells. Using western-blotting and immunofluorescence, it was found that the switch in E-cadherin/N-cadherin and vimentin expression was induced by TGF-β1, which was reversed by melatonin through the suppression of Snail and matrix metalloproteinase 9 (MMP-9), through hypoxia-inducible factor 1α (HIF-1α) inhibition. These findings demonstrated that the anticancer effects of melatonin against OA MG-63 cells is through the suppression of EMT via HIF-1α/Snail/MMP-9 signaling.
Osteosarcoma (OA) is a malignant and aggressive bone tumor prevalent in children and young adults, representing 60% of all bone tumors globally (
Melatonin is secreted by the pineal gland and plays a cyto-protective role in the regulation of oxidative stress, apoptosis-related factors and signaling pathways (
Melatonin, trypsin, MTT and Triton X-100 were purchased from Sigma Chemical Co./Merck KGaA. Dulbecco's modified Eagle's medium (DMEM), penicillin-streptomycin and fetal bovine serum (FBS) were purchased from Gibco Laboratories (Thermo Fisher Scientific, Inc.); TGF-β1 was purchased from (R&D); YC-1 (cat. no. sc-202856) was purchased from Santa Cruz Biotechnology, Inc. Antibodies against MMP-9 (cat. no. sc-13520), E-cadherin (cat. no. sc-52327), N-cadherin (cat. no. sc-8424), vimentin (cat. no. sc-53464), Snail (cat. no. sc-10437), β-actin (cat. no. sc-69879) and HIF-1α (cat. no. sc-53546) were purchased from Santa Cruz Biotechnology, Inc. The ECL kit was purchased from Pierce/Thermo Fisher Scientific, Inc. RIPA buffer and the BCA protein assay kit were purchased from Beyotime. PVDF membranes were purchased from Millipore. All reagents used were trace element analysis grade. All water used was glass distilled.
OS MG-63 cells were purchased from the Shanghai Cell Bank (Shanghai, China). The cells were treated with DMEM containing 10% FBS and 1% penicillin/streptomycin at 37°C in 5% CO2 with 95% humidity. Cells were passaged at ~80% confluency.
MG-63 cells were seeded into 96-well plates at a density of 2×104 cells/well and exposed to 0–1,000 nmol/l) melatonin for 24 h. MTT reagent (10 µl) was added to each well and incubated for 4 h at 37°C. Reaction products were extracted with DMSO (150 µl) and absorbances were recorded at ~450 nm on a microplate reader (Bio-Rad Laboratories, Inc.).
MG-63 cells were lysed in RIPA buffer and BCA assays performed. Proteins (10 µg) were resolved by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked in 5% milk in TBS (containing 0.5% Tween-20) and probed with primary antibodies at 4°C overnight. The antibodies included: Anti-β-actin (dilution 1:400), anti-HIF-1α (dilution 1:400), anti-E-cadherin (dilution 1:400), anti-N-cadherin (dilution 1:400), anti-vimentin (dilution 1:400), anti-Snail (dilution 1:400), and anti-MMP-9 (dilution 1:400). After washing three times with TBS/0.1% Tween 20, the membranes were labeled with HRP-conjugated secondary antibodies (cat. no. sc-2030; dilution 1:1,000; Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. Immunoreactive bands were visualized using ECL. The intensity of the bands was quantified using Image Lab software (version 2.1, Bio-Rad Laboratories, Inc.). All blots were representative of three independent experiments.
MG-63 cells were fixed in 4% paraformaldehyde, permeabilized in 0.2% Triton X-100 for 5 min and blocked in 10% AB-serum in 1% bovine serum albumin (BSA) for 30 min. Cells were then washed and stained with anti-E-cadherin primary antibodies (dilution 1:400) for 2 h at 37°C and incubated with TRITC-conjugated fluorescent secondary antibodies (cat. no. BA1089; dilution 1:100) for 30 min at room temperature. Nuclei were stained with Hoechst 33342 for 10 min and cell morphology was examined under an optical microscopy (magnification, ×400; Olympus Corporation).
Snail was cloned into pcDNA3.1 (Genechem Co.) and transiently transfected into MG-63 cells using Lipofectamine 2000 (Invitrogen/Thermo Fisher Scientific, Inc.). Cells were harvested 48 h post-transfection.
Total RNA was extracted using TRIzol (Invitrogen/Thermo Fisher Scientific, Inc.) and reverse transcribed using SYBR PrimeScript RT-PCR kits (Takara Inc.) according to the manufacturer's protocol. cDNAs were amplified by polymerase chain reaction (PCR) using the primers shown in
All statistical analyses were performed using SPSS (version 19.0; IBM Corp.). Data are represented as the mean ± SD. One-way ANOVA test was used for statistical comparisons. If multigroup comparisons were made, then ANOVA was used together with
EMT is key to cancer progression and can be induced by TGF-β (
Previous studies have reported that melatonin inhibits tumor invasion through EMT inhibition (
Extensive research indicates that the Snail/MMP-9 signaling plays a vital role in EMT and tumor metastasis (
The data obtained to this point suggested that Snail/MMP-9 signaling regulates EMT. To further investigate the effects of melatonin on Snail/MMP-9 signaling, Snail was overexpressed in MG-63 cells (
HIF-1α can induce EMT and metastasis in cancer cells (
Previous studies have confirmed that epithelial-to-mesenchymal transition (EMT) is a key stage in the transdifferentiation of epithelial cells and plays a central role in disease progression, wound healing, fibrosis and cancer (
Melatonin isolated from the bovine pineal has numerous physiological functions including the control of the circadian rhythm, sleep-wake rhythms, body temperature, neuronal protection and immune activation (
In the present study, the role of melatonin in inhibiting TGF-β1-mediated EMT was investigated and the signaling pathways involved in this regulation were explored. Our findings suggested that melatonin pretreatment provides effective protection against TGF-β1-mediated EMT as evidenced by the downregulation of N-cadherin and vimentin and the increased expression of E-cadherin in MG-63 cells. The mechanisms of these effects were next explored.
Snail regulates EMT and plays a crucial role in tumor invasion and metastasis (
Melatonin suppresses the viability and angiogenesis of cancer cells through the downregulation of HIF-1α/ROS/VEGF in solid tumors containing abundant blood vessels (
In summary, the present study demonstrated that melatonin attenuates TGF-β1-mediated EMT in MG-63 cells by preventing TGF-β1-induced activation of the Snail/MMP-9 and HIF-1α signaling pathways. These findings provide new insight into the mechanisms by which melatonin prevents the development and invasion of OA. These findings also provide experimental evidence for the development of new strategies for OA treatment.
Not applicable.
The present study was supported in part by a grant from the Inner Mongolia Autonomous Region Natural Science Fund Project (grant nos. 2018MS08145 and 2014MS0812), the Baotou Medical College Natural Science Fund Sailing Project (grant nos. YF201687 and BYJJ-YF201718) and the Baotou Science and Technology Plan Project (grant no. wsjj2017027).
The datasets used and/or anlayzed during the current study are available from the corresponding author on reasonable request.
YC and TZ conceived and designed the study. XL, ZL, DZ, WX and YC performed the experiments. TZ and ZL wrote the paper. YC and WX reviewed and edited the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.
All experimental protocols were approved by the Institutional Review Board of the Department of Laboratory Animal Science of Baotou Medical College (Baotou, China).
Not applicable.
The authors declare that they have no competing interests.
osteosarcoma
hypoxia-inducible factor 1α
matrix metalloproteinase 9
Dulbecco's modified Eagle's medium
epithelial-to-mesenchymal transition
phosphate-buffered saline
Tris-buffered saline
transforming growth factor
fetal bovine serum
polyvinylidene fluoride
dimethyl sulfoxide
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
EMT is triggered by TGF-β1. (A) OA MG-63 cells were treated with TGF-β1 (20 ng/ml) for 0, 12, 24 and 48 h, and E-cadherin, N-cadherin, vimentin and β-actin were analyzed by western blot analysis. Data are presented as means ± SD of 3 independent experiments. β-actin was used as the loading control. **P<0.01 vs. the 0 h group. (B) OS MG-63 cells were treated with TGF-β1 (20 ng/ml) for 0, 12, 24 and 48 h, and the levels of E-cadherin, N-cadherin, vimentin were detected by RT-PCR. Data are presented as means ± SD (n=3). GAPDH was used as the loading control. *P<0.05 and **P<0.01 vs. the 0 h group. OA, osteosarcoma; EMT, epithelial-to-mesenchymal transition; TGF-β1, transforming growth factor β1.
Melatonin reverts TGF-β1-mediated EMT in MG-63 cells. (A) OA MG-63 cells were treated with various doses of melatonin (0–1,000 nM) for 24 h, and cell viability was examined by MTT assay. Data are presented as means ± SD (n=3). (B) OS MG-63 cells were treated with 200 nM melatonin for 24 h, and cell morphology was observed under bright-field microscopy (magnification, ×100). (C) MG-63 cells were cultured with 20 ng/m TGF-β1 in the presence or absence of 200 nM melatonin for 24 h, and E-cadherin was detected by fluorescence microscopy (magnification, ×400). (D) Cells were treated as above, and E-cadherin, N-cadherin, vimentin and β-actin were detected by western-blot analysis. The results were representatives of three independent experiments. β-actin was used as loading control. **P<0.01 vs. the control group; #P<0.01, the TGF-β1 group vs. the TGF-β1 + melatonin group). OA, osteosarcoma; EMT, epithelial-to-mesenchymal transition; TGF-β1, transforming growth factor β1.
Melatonin suppresses the Snail/MMP-9 and HIF-1α pathway. (A and B) OA MG-63 cells were exposed to TGF-β1 (20 ng/ml) for 0, 12, 24 and 48 h, and then MMP-9, Snail and β-actin were assessed by western blot analysis. In B: Data are presented as means ± SD of 3 independent experiments. β-actin was used as the loading control. *P<0.05, **P<0.01 vs. the 0 h group. (C and D) MG-63 cells were cultured with 20 ng/m TGF-β1 in the presence or absence of 200 nM melatonin for 24 h, and MMP-9, Snail and β-actin were detected by western blot analysis. In D: Data are presented as means ± SD of 3 independent experiments. β-actin was used as the loading control. **P<0.01 vs. the control group; #P<0.01, TGF-β1 group vs. the TGF-β1 + melatonin group. (E) MG-63 cells were exposed to TGF-β1 (20 ng/ml) for 0, 12, 24 and 48 h, and HIF-1α and β-actin were assessed by western blot analysis. Data are presented as means ± SD of 3 independent experiments. **P<0.01 vs. the 0 h group. (F) MG-63 cells were cultured with 20 ng/m TGF-β1 in the presence or absence of 200 nM melatonin for 24 h, and HIF-1α and β-actin were detected by western blot analysis. Data are presented as means ± SD of 3 independent experiments. **P<0.01 vs. the control group; #P<0.01, TGF-β1 group vs. the TGF-β1 + melatonin group. OA, osteosarcoma; HIF-1α, hypoxia-inducible factor 1α; MMP-9, matrix metalloproteinase 9; TGF-β1, transforming growth factor β1.
Overexpression of Snail reverses melatonin-mediated suppression of EMT in MG-63 cells. (A) OA MG-63 cells were transfected with the Snail-pcDNA3.1 plasmid and the Snail mRNA level at different time intervals (0, 6, 12, 24 h) was determined by RT-PCR. GAPDH was used as the loading control. Data are represented as mean ± SD (n=5). **P<0.01 vs. the 0 h group. (B) Control and Snail-overexpressing cells (pCDNA3.1-Snail) (after transfection for 24 h) were exposed to 20 ng/m TGF-β1 in the presence or absence of 200 nM melatonin for 24 h, and Snail, E-cadherin, N-cadherin, vimentin and β-actin were measured by western blot analysis. Data are presented as means ± SD of 3 independent experiments. β-actin was used as the loading control. **P<0.01 control cells: TGF-β1 group vs. the TGF-β1 + melatonin group; #P>0.05 pcDNA3.1-Snail cells: TGF-β1 group vs. the TGF-β1 + melatonin group). OA, osteosarcoma; EMT, epithelial-to-mesenchymal transition; TGF-β1, transforming growth factor β1.
YC-1 reverts TGF-β1-mediated upregulation of MMP-9 and Snail in OA MG-63 cells. Exposure of control cells to TGF-β1 (20 ng/ml) and YC-1 (30 µmol/l) for 24 h and the levels of HIF-1α, MMP-9 and Snail were detected by RT-PCR. GAPDH was used as the loading control. Data are presented as mean ± SD (n=5). **P<0.01 vs. the control; #P<0.01, TGF-β1 group vs. the TGF-β1 + YC-1 group. OA, osteosarcoma; MMP-9, matrix metalloproteinase 9; TGF-β1, transforming growth factor β1.
Primer sequences.
Genes | Forward primer | Reverse primer |
---|---|---|
AAGGCCTTCTCTAGGCCCT | CGCAGGTTGGAGCGGTCAG | |
TTCCTTCTCTTCTCCGCGTG | ACTTATCTTTTTCTTGTCGTTCGC | |
TTGACAGCGACAAGAAGTGG | CCCTCAGTGAAGCGGTACAT | |
GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |