Lumbar laminectomy is commonly deemed as the most valid surgery for a series of lumbar illnesses, such as lumbar disc herniation, which could lead to spinal canal stenosis. However, epidural fibrosis is one of the most common complications that limits the application of lumbar laminectomy, which is mainly caused by proliferation of local fibroblasts. Laminins are glycoproteins that consist of α, β and γ chains, which serve a crucial role in biological cell behaviors, such as adhesion, differentiation, migration and proliferation, especially the isoform with the fifth α chain-laminin α5. The PI3K/AKT/mTOR signaling pathway was demonstrated to be associated with various biological functions in cells. The aim of the present study was to explore whether laminin α5 is an important factor in epidural fibrosis by modulating the proliferation of fibroblasts through the activation of PI3K/AKT/mTOR signaling pathway. In the animal model, the results of the hematoxylin-eosin staining, cell counting, Masson's trichrome staining and immunohistochemical staining showed laminin α5 to be positively associated with epidural fibrosis. Furthermore, to verify the assumption that laminin α5 could modulate fibroblast proliferation through the PI3K/AKT/mTOR signal pathway, fibroblasts were transfected with laminin α5-small interfering (si)RNA. The results of western blotting (proliferating cell nuclear antigen and cyclin D1), the Cell Counting Kit-8 and EdU incorporation assays indicated that the proliferative level of fibroblasts decreased, and the expression of phosphorylated (p)-focal adhesion kinase 1, p-AKT and p-mTOR was reduced. Subsequently, laminin α5 was overexpressed and the change in cell proliferation and expression of associated proteins contrasted with that observed in siRNA. The results demonstrated that laminin α5 could interfere the activation of the PI3K/AKT/mTOR signaling pathway. Finally, the inhibition of the PI3K/AKT/mTOR signaling pathway by LY294002 resulted in decreased fibroblast proliferation. In conclusion, laminin α5 could modulate fibroblast proliferation in epidural fibrosis through the PI3K/AKT/mTOR signaling pathway.
In the current medical field, the lumbar laminectomy is deemed the most valid treatment for lumbar illnesses; these include lumbar disc herniation and other associated diseases, which may result in spinal canal stenosis. However, due to inaccurate recognition and inadequate treatment, following surgery the formation of fibrosis on local dura and lumbosacral adhesive arachnoiditis occurs (
Laminins are a type of biofunctional glycoprotein in the extracellular matrix, which consist of three different polypeptide α, β and γ chains with disulfide bonds; there are five kinds of α chains (α1-α5), three β chains (β1-β3) and three γ chains (γ1-γ3) (
The PI3K/AKT/mTOR signaling pathway is a classical pathway, which has been demonstrated to be associated with various biological cell behaviors including proliferation (
A total of 40 Sprague-Dawley male rats (mean weight, 250 g; age, 8 weeks) were provided by the Medical College of Yangzhou University (Yangzhou, China). The rats were acclimatized for a week to adapt to the laboratory environment of 23±2°C and 50–60% humidity, with a 12-h light/dark cycle and free access to food and water. Rats were then randomly divided into two groups: 2-week group and 4-week group (the number represents the postoperative euthanasia-time; 20 rats per group). During the preparation process, all rats were appropriately treated according to the standards of International Laboratory Animal Care.
To simulate the situation of clinical patients, lumbar laminectomy was carefully performed in all rats according to a laminectomy model and the procedure was conducted as previously reported (
After lumbar laminectomy operation, the two groups of rats were individually euthanized at 2 and 4 weeks to perform histological analysis to detect the degree of local fibrosis. The rats were anesthetized with 1% pentobarbital sodium and perfused with 4% paraformaldehyde intracardially for euthanasia. Subsequently, the L1 and L2 lumbar column with local muscles and epidural fibrosis were excised and fixed with 10% buffered formalin for one week at room temperature, then immersed in Ethylene Diamine Tetraacetic Acid (EDTA) for 40 days for decalcification. Finally, the columns were embedded in paraffin and then sliced into successive 4-µm transverse sections.
For H&E staining, the sections were subsequently stained with hematoxylin for 5 min and then eosin for 5 min, both at room temperature. For Masson trichrome staining, the sections were subsequently immersed in 50% potassium dichromate overnight at room temperature, stained with hematoxylin for 3 min at room temperature and incubated in Ponceau S dye for 5 min at room temperature. Then, the sections were washed and incubated with 1% phosphomolybdic acid for 2 min at room temperature prior to being stained with aniline blue for 5 min at room temperature. The degree of fibrosis, local fibroblast counting, and the content of epidural collagen were observed by optical photographic light microscopy at ×40 and ×200 magnification. Stained cells were counted in three random views of fibrotic area per section by Image Pro Plus 6.0 software (Media Cybernetics, Inc.).
Following the initial fixing steps described above and obtaining paraffin-embedded sections (4 µm), immunohistochemistry analysis of laminin α5 protein expression was performed with a Ready-to-use HP IHC detection kit (Absin Bioscience, Inc.), according to the manufacturer's protocol. Briefly, sections of each group underwent antigen retrieval in sodium citrate at 100°C for 20 min. Sections were subsequently deparaffinized in xylene at room temperature and rehydrated in a descending alcohol series (100, 85 and 75%), and blocked in 100% FBS (Gibco; Thermo Fisher Scientific, Inc.) for 15 min at room temperature. Sections were subsequently incubated with the laminin α5 primary antibody (1:200; cat. no. NBP2-42391; Novus Biologicals, Ltd.) at 4°C overnight, then incubated with the secondary antibody included in the kit at room temperature for 2 h. Finally, the sections were stained with DAB reagent for 2 min at room temperature and then, hematoxylin for 2 min at room temperature. Stained cells were observed under an optical photographic light microscope at ×200 magnification and analyzed by Image Pro Plus 6.0 software (Media Cybernetics, Inc.).
The human fibroblasts were obtained from Shanghai Cell Repository of the Chinese Academy of Sciences. Cells were cultured at 37°C in 5% CO2 with DMEM (Gibco; Thermo Fisher Scientific, Inc.), supplemented with 15% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin & streptomycin (Gibco; Thermo Fisher Scientific, Inc.). A total of 1×106 fibroblasts were seeded in petri dishes with a variety of specifications overnight until a confluence of 70% was attained; then the dishes were washed twice with PBS. One third of the fibroblasts were set as the LY group and were treated with the PI3K inhibitor LY294002 (MedChemExpress) diluted in dimethylsulfoxide to 50 µM for 24 h. Another third of the fibroblasts were treated with siRNA for knockdown or lentiviral vectors for overexpression. All fibroblasts were maintained in the growth phase between 3 and 6 passages.
siRNA of laminin α5 (5′-GCATCAGCTTCGACAGTCA-3′) and the negative control (cat. no. siN0000001-1-5; with same sequence length as siRNA-laminin α5 but non-targeting) were purchased from Guangzhou RiboBio, Co., Ltd. The fibroblasts were transfected with 50 nM siRNA at a confluence of 70% for 48 h with Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.) and Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), following the manufacturer's protocol. The efficiency of transfection was detected by reverse transcription-quantitative PCR (RT-qPCR) and immunofluorescence. Transfected cells were maintained in culture for 48 h prior to subsequent experiments.
The GV418 and GV419 lentiviral vectors for overexpressing the laminin α5 target gene and the scramble control (empty vector) were obtained from Shanghai Genechem Co., Ltd. Lentiviral infection was performed to overexpress laminin α5 following the manufacturer's protocol. Fibroblasts in the overexpression and scramble control group were cultured until they reached 70% confluence. Subsequently, 1×106 fibroblasts/well were transfected with 2×107 TU (multiplicity of infection of 20) laminin α5 GV418 lentiviral vector or GV418 scramble control empty vector overnight in the presence of 2 mg/ml polybrene (Gibco; Thermo Fisher Scientific, Inc.) and then replaced with fresh complete medium. After 48 h-transfection at 37°C, cells were cultured in puromycin (Sigma-Aldrich; Merck KGaA) at a concentration of 2 µg/ml for 72 h for the preliminary screening to eliminate non-transfected cells.
Subsequently, the laminin α5 overexpression GV419 lentiviral and the GV419 scramble control empty vector were transfected into 1×106 fibroblasts as described previously. Then, fibroblasts were screened with 400 µg/ml G418 Sulfate (Thermo Fisher Scientific, Inc.) for 72 h. The transfection efficiency was verified as aforementioned, with an untreated group used as the control group, and cells were kept in culture for subsequent experiments.
Total RNA was extracted from fibroblasts with TRIzol® reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Reverse transcription to cDNA was performed using the FastKing DNA Dispelling RT SuperMix (Tiangen Biotech Co., Ltd.), according to the manufacturer's protocol. The RT conditions were 42°C for 15 min and 95°C for 3 min. All qPCR reactions were run on the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Inc.) with a SYBR® Green Master Mix kit (Vazyme Biotech Co. Ltd), according to the manufacturer's protocol. The primers used are displaying in
A total of 3×106 fibroblasts were lysed on ice with RIPA lysis buffer (Beyotime Institute of Biotechnology), according to the manufacturer's protocol. Total protein concentration was determined with a bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). Western blot analysis was performed as previously reported (
A total of 2.5×105 fibroblasts from each group were simultaneously cultured in 24-well plates overnight until 70% confluent. Then cells were fixed with 4% polyoxymethylene in PBS at room temperature for 15 min, then immersed in 0.1% Triton X-100. Subsequently, the sections were blocked in 3% BSA (Gibco; Thermo Fisher Scientific, Inc.) for 30 min at room temperature and incubated with anti-laminin α5 primary antibody (1:100; cat. no. 220399; Abcam) overnight at 4°C and probed with a FITC-conjugated goat anti-rabbit IgG secondary antibody (1:200; cat. no. 33112ES60; Yeasen Biotechnology (Shanghai) Co., Ltd.) for 2 h at room temperature. Finally, the cell nuclei were stained with Hoechst for 5 min at room temperature, then observed with a Zeiss inverted fluorescence microscope (magnification, ×200) to determine the expression levels of the target protein. The data were analyzed using Image Pro Plus 6.0 (Media Cybernetics, Inc.).
Cell viability was analyzed using the Cell Counting Kit-8 assay (CCK-8; cat. no. CK04; Dojindo Molecular Technologies, Inc.), according to the manufacturer's protocol. Fibroblasts were cultured in triplicate in 96-well plates for 24 h at 37°C, then treated with 10 µl CCK-8 reagent for 2 h at 37°C. The optical density value at 450 nm was determined with a microplate absorbance reader (Bio-Tek; Elx800). The cell survival rate was calculated according to the manufacturer's specification.
The EdU incorporation assay was conducted to evaluate fibroblast proliferation. The kFlour555 Click-iT EdU kit was obtained from KeyGen Biotech Co., Ltd. A total of 2.5×105 fibroblasts were cultured in 24-well plates for 24 h until 70% confluent. Then cells were subsequently incubated in 10 µmol/l EdU working solution for 2 h at 37°C, fixed in 4% polyoxymethylene for 30 min at room temperature and incubated with 0.5% Triton X-100 for 20 min in the dark at room temperature. After immerged in Click-iT mixture system, cell nuclei were stained with Hoechst 33342 for 5 min at room temperature. Finally, the cells were observed under a Zeiss inverted fluorescence microscope (magnification, ×200). Orange was deemed as a positive signal of proliferation and the cell nucleus was royal blue. The positive EdU rate was calculated using ImageJ software.
The data of the present study are presented as the mean ± SD and statistical analysis was performed using SPSS 19.0 statistical software (IBM Corp.). Each experiment was performed in triplicate. The significance of the differences among groups was evaluated by Student's t-test or one-way ANOVA followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
To detect epidural fibroblast density and fibrosis, histological analysis by H&E staining, fibroblast counting, and Masson trichrome stains were performed. As shown in
Based on the results of the animal model, the effect of laminin α5 on fibroblast proliferation was further studied. The fibroblasts were transfected with laminin α5 siRNA, which was followed with RT-qPCR and immunofluorescence to detect the transfection efficiency. As shown in
After transfection with laminin α5 siRNA, western blotting was performed to determine the influence of target proteins of the PI3K/AKT/mTOR signaling pathway. The results indicated that after gene knockdown, the expression ratio of p-AKT/AKT and p-mTOR/mTOR significantly decreased compared with the control group (P<0.05;
To confirm whether PI3K/AKT/mTOR signaling could regulate fibroblast proliferation, cells were treated with the signaling pathway inhibitor LY294002. Following treatment with LY294002 for 24 h, western blotting was performed to detect the expression of PCNA, cyclin D1, p-AKT and p-mTOR. As shown in
Previous studies have indicated the epidural fibrosis on dura mater after laminectomy operation, which ultimately results in a negative outcome for patients (
The extracellular matrix is a structure with an important role to support cell construction and promote various functions, such as adhesion, differentiation, migration and proliferation, which are also associated with the development of numerous diseases (
Several studies have illustrated that the PI3K/AKT/mTOR signaling pathway modulates cellular proliferation and various biological behaviors (
In the initiation of the present study, the association between laminin α5 and epidural fibrosis was investigated. There are a series of methods to detect the epidural fibrosis formation, such as H&E staining, Masson trichrome stains, local fibroblast number counting (
After animal model experiments, analysis was conducted at the cellular level to study the detail of the mechanism involved in laminin α5 and fibroblast proliferation. Laminin α5 was knocked down for further studies including western blotting, EdU incorporation assay and CCK-8 assay, which showed that fibroblasts following knockdown presented a lower level of proliferation and cell vitality. For further confirmation, the laminin α5 was overexpressed, in which the present study demonstrated an increase in cell proliferation. The results indicated that laminin α5 could modulate fibroblast proliferation, which is similar to previous studies where laminin α5 played a marked role in cell behaviors, such as proliferation (
Fukumoto
In conclusion, the present study confirmed the association between laminin α5 and epidural fibrosis. Furthermore, a possible mechanism was also found that laminin α5 might modulate fibroblast proliferation through the PI3K/AKT/mTOR signaling pathway. The results of this study could indicate a potential treatment to prevent epidural fibrosis. However, due to time limitations in this study, there are also more complex experiments have not been performed such as using an inducible laminin α5 knockout mouse which would take 1–2 years. In the future, the present authors may perform this experiment to aid further conclusions and find out more regarding the potential mechanism.
Not applicable.
The present study was supported by the National Natural Science Foundation of China (grant nos. 81772331, 81371971 and 81271994), the Jiangsu Provincial Medical Youth Talent (grant no. QNRC2016344), the Six talent peaks project of Jiangsu Province (grant no. 2015-WSN-108 and 2015 WSN 110), the Jiangsu Provincial 333 Project Foundation (grant no. BRA2018194), the Social Development Projects of Yangzhou Science and Technology Bureau (grant no. YZ2017073), the China Postdoctoral Science Foundation (grant no. 2016M590431) and the Jiangsu Provincial Medical Innovation Team (grant no. CXTDB2017004).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
PL designed the research, performed the experiments and wrote the manuscript. HC contributed to the reagents, materials, analysis tools and analyzed the data. LY prepared the figures and tables. YS helped design the experiments, prepared the animal models and collected the tissue, and reviewed the drafts of the manuscript.
The present study protocol was approved by the Research Ethics Committee of the Northern Jiangsu People's Hospital (Yangzhou, China) and written informed consent was obtained from all the participants for their tissues to be used for the purposes of this research.
Not applicable.
The authors declare that they have no competing interests.
Laminin α5 expression is related to epidural fibrosis. (A) In H&E staining, excessive fibrosis ‘*’ with thick adherence to spinal dura was observed in the 4 weeks group. In the 2 weeks group, there were notably fewer areas of fibrosis, which was observed in a time-dependent manner. In the images, the surgical area is marked by ‘L’ and the spinal cord by ‘S’. Magnification, ×40. (B) In Masson's trichrome staining, collagen is indicated in royal blue. Images indicated that epidural collagen was gradually synthesized with increasing time. Magnification, ×40. (C) H&E staining images showed that the number of fibroblasts within the surgical area around the spinal dura increased with time, as shown in the histogram. Magnification, ×200. The data are presented as the mean ± SD of the two groups. *P<0.05. (D) Immunohistochemical staining of laminin α5 in epidural fibrosis tissues. The results of laminin α5 expression are shown as the mean integral OD in the histogram. Magnification, ×200. Analysis was conducted using Image Pro Plus 6.0 (Media Cybernetics, Inc.). The data are presented as the mean ± SD of two groups, *P<0.05. SD, standard deviation; H&E, hematoxylin and eosin; OD, optical density.
Efficiency of laminin α5 siRNA-knockdown by RT-qPCR and immunofluorescence. (A) The immunofluorescence assay of laminin α5 indicated that the fluorescence density level of the siRNA group was significantly decreased compared with the control group. No statistical significance was observed among the control and negative control groups. The data are presented as the mean ± SD of three independent groups. *P<0.05. (B) RT-qPCR indicated a downregulated mRNA level in the siRNA group. GAPDH was used as the control. The data were presented as the mean ± SD of three independent groups. *P<0.05. SD, standard deviation; RT-q, reverse transcription-quantitative; si, small interfering; NS, not significant; DAPI, 4′,6-diamidino-2-phenylindole.
Knockdown of laminin α5 decreases fibroblast proliferation. (A) Western blotting assays demonstrated that the expression of PCNA and cyclin D1 in the siRNA group were increased compared with in the control group. GAPDH was set as the control. The data are presented as the mean ± SD of three independent groups. *P<0.05. (B) Fibroblast proliferation level was detected by EdU incorporation assay. Positive rate was shown as the mean ± SD. *P<0.05. (C) Viability was determined by Cell Counting Kit-8 assay. *P<0.05. si, small interfering RNA; PCNA, proliferating cell nuclear antigen; NS, not significant.
Overexpression of laminin α5 promotes fibroblast proliferation. (A) Efficiency of laminin α5 overexpression by reverse transcription-quantitative PCR and immunofluorescence assays. The data are presented as the mean ± SD of three independent groups. *P<0.05. (B) Fibroblast proliferation level was detected by EdU incorporation assay. The positive rate is shown as the mean ± SD. *P<0.05. (C) Western blot assay of PCNA and cyclin D1 levels. GAPDH was set as the control. The data are presented as the mean ± SD of three independent groups. *P<0.05. SD, standard deviation; PCNA, proliferating cell nuclear antigen; NS, not significant; DAPI, 4′,6-diamidino-2-phenylindole.
Laminin α5 interferes with the activation of the PI3K/AKT/mTOR signaling pathway. (A) Knockdown of laminin α5 reduces the activation of the PI3K/AKT/mTOR signaling pathway. Western blotting of p-FAK, FAK, p-AKT, AKT, p-mTOR and mTOR expression levels in fibroblasts within the control, siRNA and negative control groups. GAPDH was set as the control. The data are presented as the mean ± SD of three independent experiments. *P<0.05. (B) Overexpression of laminin α5 promotes the activation of the PI3K/AKT/mTOR signaling pathway. Western blot assay of p-FKA, FAK, p-AKT, AKT, p-mTOR and mTOR expression levels in fibroblasts within the control, scramble control and overexpression group. GAPDH was set as the control. The data are presented as the mean ± SD of three independent groups. *P<0.05. SD, standard deviation; si, small interfering RNA; p, phosphorylated; FAK, focal adhesion kinase; AKT, protein kinase B; mTOR, mammalian target of rapamycin; PI3K, phosphoinositide 3 kinase; NS, not significant.
PI3K/AKT/mTOR signaling regulates fibroblast proliferation. (A) Western blot analysis of p-AKT, AKT, p-mTOR and mTOR expression levels in fibroblasts of the control and LY294002 group. GAPDH was set as the control. *P<0.05. (B) Western blotting of PCNA and cyclin D1 expression levels in fibroblasts of control and LY294002 group. GAPDH was set as the control. *P<0.05. SD, standard deviation; p, phosphorylated; PCNA, proliferating cell nuclear antigen.
Primers for reverse transcription-quantitative PCR.
Gene | Primer sequence (5′→3′) |
---|---|
Laminin α5 | F: TGCACCCGCCCTACTTCAA |
R: GGGTGACGTTGACCTCGTTGTA | |
GAPDH | F: GAAGCTTGTCATCAATGGAAAT |
R: TGATGACCCTTTTGGCTCCC |
F, forward; R, reverse.