Investigating the determinants and dynamics of atherosclerotic plaque instability is a key area of current cardiovascular research. Extracellular matrix degradation from excessive proteolysis induced by enzymes such as cathepsin K (Cat K) is implicated in the pathogenesis of unstable plaques. The current study assessed the expression of Cat K in human unstable atherosclerotic plaques. Specimens of popliteal arteries with atherosclerotic plaques were classified as stable (<40% lipid core plaque area; n=6) or unstable (≥40% lipid core plaque area; n=14) based on histopathological examinations of hematoxylin and eosin stained sections. The expression of Cat K and cystatin C (Cys C) were assessed by immunohistochemical examination and levels of Cat K mRNA were detected by semi-quantitative reverse transcriptase polymerase chain reaction. Morphological changes including a larger lipid core, endothelial proliferation with foam cells and destruction of internal elastic lamina were observed in unstable atherosclerotic plaques. In unstable plaques, the expression of Cat K protein and mRNA was upregulated, whereas Cys C protein expression was downregulated. The interplay between Cat K and Cys C may underlie the progression of plaques from stable to unstable and the current study indicated that Cat K and Cys C are potential targets for preventing and treating vulnerable atherosclerotic plaque ruptures.
Atherosclerosis is the principal pathological change that occurs in cardiovascular disease, which is a leading cause of mortality and morbidity worldwide (
Plaque instability may be caused by extracellular matrix degradation due to excessive proteolysis (
The increased expression of Cat K in macrophages and vascular smooth muscle cells in the atherosclerotic plaque contrasts with its minimal expression in healthy arteries (
The current study assessed Cat K expression in stable and unstable atherosclerotic plaques sourced from the human popliteal artery to determine the association of Cat K and Cys C expression with plaque instability. The regulatory mechanism for Cat K expression in plaques was investigated to identify potential therapeutic targets.
Between March 2008 and March 2010, 18 patients [14 men (age range, 48–77 years) and 4 women (age range 58–81 years)] with lower extremity arteriosclerosis obliterans undergoing amputation and 10 patients [6 men (age range, 31–42 years) and 4 women (age range, 33–38 years)] undergoing subtotal gastrectomy at the First Hospital of Jilin University (Jilin, China) were enrolled in the current study. All patients in the control group were determined to not exhibit the disease (osteoporosis or rheumatoid arthritis) and were ages between 18 and 85 years old. Popliteal artery specimens with atherosclerotic plaques were collected from the amputated lower extremities. Mesenteric artery specimens without atherosclerotic plaques were sourced from the subtotal gastrectomy specimens. All arterial specimens were washed in phosphate-buffered saline (PBS) and longitudinally sectioned into two halves. One half was immediately frozen and stored at −80°C prior to RNA extraction; the other half was fixed in 4% paraformaldehyde for 24 h at room temperature prior to hematoxylin and eosin (H&E) staining and immunohistochemical analysis. Sample collections and operations were performed in accordance with the ethical guidelines of the 2013 Declaration of Helsinki and ethical approval for the current study was obtained from the Ethics Committee at Jilin University (Jilin, China). Written informed consent was obtained from all patients prior to their enrollment.
Morphological characteristics of the atherosclerotic plaque were detected by H&E staining and plaques were subsequently classified as stable or unstable. Fixed samples were demineralized with 12.5% disodium ethylenediamine tetraacetic acid (EDTA) at room temperature for 1 week and 3-µm thick sections were prepared. H&E-stained sections were observed using a light microscope (BX51; Olympus Corp., Tokyo, Japan) at magnifications of ×40, ×100 or ×400. All examinations were conducted independently by two investigators. Atherosclerotic plaques with a core lipid pool accounting for >40% of the total plaque area were classified as unstable; all other plaques were classified as stable (
The expression of Cat K and Cys C in plaques was determined following immunohistochemical examinations. Antibodies against human Cat K (bs-1611R) were purchased from Beijing Biosynthesis Biotechnology Co., Ltd. (Beijing, China) and those against human Cys C (IT-010-006) were purchased from Abcam (Cambridge, MA, US). Arterial sections that were 3 µm thick were fixed in 5% formaldehyde for 7 days at room temperature and serially dehydrated in successively decreasing concentrations of ethanol (100, 95, 90, 80 and 70%). Following dehydration, sections were attached to poly-l-lysine glass slides, rinsed with PBS (0.01 M, pH 7.4) and treated with hydrogen peroxide to deactivate endogenous peroxides. Sections were blocked for 1 h at room temperature with 1% bovine serum albumin obtained from Beijing Dingguo Changsheng Biotechnology, Co., Ltd. (Beijing, China) in PBS, followed by incubation with the antibodies against Cat K and Cys C (1:100 dilution) for 12 h at 44°C. Following rinsing in PBS 3 times, specimens were incubated with biotinylated secondary antibody at a dilution of 1:100 (SP9710; Fuzhou Maixin Biotech. Co., Ltd, Fuzhou, China) for 10 min at 37°C. Specimens were then incubated with horseradish peroxidase conjugated streptavidin solution for 10 min at 37°C, followed by incubation with diaminobenzidine for 1–2 min at 37°C. Stained sections were counterstained with H&E and examined under a light microscope at magnifications of ×40, ×100 and ×400. The staining density for Cat K and Cys C immunopositive nuclei and cytoplasm were examined in five randomly selected fields using gray scale analysis (Images Advanced 3.2 systems; Motic Co., Xiamen, China).
The expression of Cat K mRNA was measured by semi-quantitative RT-PCR. Total RNA was extracted from plaque tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), following the manufacturer's instructions. Total RNA was determined by the ratio of optical density readings at 260 and 280 nm and integrity of the specimen was assessed using 1.8% agarose gel electrophoresis. Rat GAPDH, a housekeeping gene, was used as an internal reference. The sequences of the primers used (Sangon Biotech Co., Ltd., Shanghai, China) and parameters of Cat K and GAPDH for amplification are listed in
RT-PCR was performed using the Gene Amplify PCR System (Takara Bio, Inc., Otsu, Japan). Amplification specimens were subjected to electrophoresis on a 1.8% agarose gel (Beijing Dingguo Changsheng Biotechnology, Co., Ltd., Beijing, China), visualized following staining with 0.5 g/ml ethidium bromide (Beijing Dingguo Biotechnology, Co., Ltd.) and images were acquired. An image analysis system (Tanon-4200; Tanon Science & Technology, Co., Ltd., Shanghai, China) was used to scan gel images and the relative intensity of specific PCR bands was determined in relation to GAPDH bands from the same sample.
Data were expressed as the mean ± standard deviation. One-way analysis of variance followed by Bonferroni's multiple comparison tests was used to assess between-group differences. Spearman's correlation was used to assess the correlation between the expression of Cat K and Cys C. All statistical analyses were assessed using SPSS 19.0 (IBM Corp., Armonk, NY, USA) and P<0.05 was considered to indicate a statistically significant difference.
Six specimens of atherosclerotic tissue were classified as stable plaque and 14 were classified as unstable plaque. Orderly arrangements of endothelial cells and smooth endomembranes were observed in mesenteric artery specimens from controls. No thickening of the media or presence of a lipid core was observed (
In stable atherosclerotic plaques from popliteal arteries, the proliferation of endothelial cells and internal elastic lamina was detected (
Positive brown staining for Cat K was observed in atherosclerotic plaques. In the mesenteric artery specimens from controls, there was weak positive staining for Cat K in the intimal and medial cells (
Gray scale analyses indicated that the intensity of positive staining for Cat K in stable (161.75±1.38) and unstable (163.9±1.331) plaques was significantly greater than that in normal control mesenteric arteries (120.7±4.18; both P<0.05). Furthermore, the intensity of positive staining for Cat K in unstable plaque specimens was significantly greater than that of stable plaque specimens (P<0.05;
Levels of Cat K mRNA were significantly upregulated in stable and unstable plaques compared with normal mesenteric artery specimens (both P<0.05). Furthermore, levels of Cat K mRNA in unstable plaques were significantly greater than in stable plaques (P<0.05;
The positive expression of Cys C was indicated by deep brown staining. In the mesenteric arteries from controls, there was positive staining for Cat K in the intimal and medial cells (
Grayscale analyses demonstrated that the intensity of positive staining for Cys C in stable (127.20±2.269) and unstable (121.9±1.732) plaque specimens was significantly higher than that in normal mesenteric artery specimens (137.8±3.323; P<0.05 for both). In addition, the intensity of staining in unstable plaque specimens was significantly higher than that of the stable plaque specimens (P<0.05;
The association between the expression of Cat K and Cys C in unstable popliteal artery plaques was assessed using Spearman's correlation analysis. In unstable plaques, an inverse association was observed between the expression of Cat K and Cys C (r=−0.9228, P=0.0011).
The current study investigated the association between Cat K and plaque instability in human atherosclerotic plaques. The expression of Cat K mRNA and protein in stable and unstable popliteal artery plaques was greater than that of control mesenteric artery specimens. Furthermore, the expression of Cat K mRNA and protein in unstable plaque was significantly higher than in stable plaques. By contrast, a decrease in the expression of Cys C was detected in stable and unstable plaques and the expression of Cys C in unstable plaques was significantly lower than in stable plaques.
Notably, the decrease in Cys C expression in the atherosclerotic plaques was negatively correlated with an increase in Cat K expression. These results suggest that the elevation of Cat K expression may stimulate the progression of atherosclerotic plaques from stable to unstable. Low expression of Cys C is associated with the high expression of Cat K, therefore Cat K and Cys C may be potential therapeutic targets for preventing and treating unstable atherosclerotic plaques.
Non-ruptured plaques with a large lipid-rich necrotic core and thinned out collagen-depleted fibrous cap, which exhibit smooth muscle cell proliferation, intimal and adventitial inflammation and microcalcification are considered to be unstable or vulnerable plaques, owing to their heightened risk of rupture (
In the current study, it was demonstrated that the expression of Cat K mRNA and protein in unstable plaques was significantly higher than in stable plaques. Cat K is a papain-like cysteine peptidase. Its physiological role is reflected in its distinctive cleavage model for type I collagen molecules, which is different from that of the other endogenous collagenases (
The accumulation of oxidized lipids and apoptotic cells in atherosclerotic lesions contributes to plaque rupture and its associated clinical complications (
In the current study, the elevated expression of Cat K and downregulation of Cys C in unstable plaques was detected. Atherosclerotic mice (apoE−/− mice) deficient in Cys C exhibited increased degradation of elastic lamina as well as the formation of larger plaques (
There were a number of limitations of the current study. Only the expression of Cat K and Cys C were assessed; their activities were not included in the scope of the study. Additionally, the dynamic interplay between Cat K and Cys C in the transformation of atherosclerotic plaques from stable to unstable and the underlying mechanism of action require further clarification. Furthermore, it remains unknown whether inhibiting Cat K and/or activating Cys C are able to attenuate or reverse plaque transformation.
In conclusion, the current study demonstrated that Cat K expression in unstable human popliteal artery plaques was negatively correlated with Cys C expression. The interplay between Cat K and Cys C expression may serve a fundamental role in the progression of plaques from stable to unstable. Therefore, Cat K and Cys C may be potential targets to prevent and treat unstable atherosclerotic plaques.
The present study was supported by the National Natural Science Foundation of China (no. 51372096) and the Province Natural Science Foundation of Jilin, China (no. 201015143).
Histopathological characteristics of arteries with and without atherosclerotic plaques. (A) Representative images of control mesenteric artery (n=10; magnification, ×100) presenting the structural integrity of the vascular wall, smooth intima, arranged endothelial cells, smooth muscle cells and lack of medial hyperplasia, and outer layer of loose connective tissue. (B) Representative images of popliteal artery with stable plaques (n=6; magnification, ×100) exhibiting eccentric intimal thickening and no clear lipid core. The plaque is composed of foam cells with pink lipid deposition and the internal elastic lamina is clear. The media exhibited SMC proliferation, disordered arrangements and inflammatory cell infiltration. (C) Representative images of the popliteal artery with unstable plaque (n=14; magnification, ×100). Numerous uniform pink lipid deposits (indicated by white arrow), formation of cavity following dissolution of lipids, calcium deposits (purple), foam cells and destruction of the internal elastic lamina are visible in the intima. The red arrow indicates SMC proliferation, disordered arrangement, foam cell infiltration, calcium deposits, lipid deposition and the presence of cholesterol crystals in the media. SMC, smooth muscle cell.
Cat K expression in arterial specimens with and without atherosclerotic plaques. (A) Representative image of mesenteric artery specimens from controls (n=10; magnification, ×100) indicating mild positive Cat K staining in the intima and uniform brown Cat K staining in the cytoplasm of SMCs in media. (B) Representative image of stable popliteal artery plaque (n=6; magnification, ×100) indicating foam cell infiltration in the intima and plaque, strongly positive Cat K staining (brown granular) in the intima and plaque and slight granular positive Cat K staining in the media. (C) Representative image of unstable popliteal artery plaque (n=14, magnification, ×100) presenting high intensity of Cat K staining in the plaque, intima and media (visible as brown flakiness). Unstable plaques exhibited marked intimal thickening, accumulation of foam cells and brown granular Cat K staining in the foam cells and SMC of media. (D) Statistical analyses of Cat K expression. Positive Cat K gray intensity in unstable plaque specimens was significantly lower than that in the stable plaque specimens. The results presented the expression of Cat K in the UP compared with the SP. *P<0.05 vs. Con, #P<0.05 vs. SP. Cat K, cathepsin K; Con, control group; SP, stable plaque group; UP, unstable plaque group; SMC, smooth muscle cell.
Levels of Cat K mRNA in arterial specimens with and without atherosclerotic plaques. (A) Representative image of Cat K and GAPDH following agarose gel electrophoresis. Lane 1, DNA markers; lanes 2 and 3, Con; lanes 4 and 5, UP; lanes 6 and 7, SP. (B) Statistical analyses of Cat K mRNA expression. mRNA expression in unstable plaques was significantly greater than in stable plaques. *P<0.05 vs. Con; #P<0.05 vs. SP. Cat K, cathepsin K; Con, control group; SP, stable plaque group; UP, unstable plaque group; bp, base pairs.
Expression of Cys C protein in arterial specimens with and without atherosclerotic plaques. (A) Representative image of mesenteric artery specimens from controls (n=10; magnification, ×100) indicating abundant positive staining for Cat K in the intimal and medial cells (deep brown flakiness). (B) Representative image of stable popliteal artery plaque (n=6; magnification, ×100) indicating foam cell infiltration, dark brown granular Cys C staining of the intimal layer and mild Cys C staining (deep brown particles) in the media. (C) Representative image of unstable popliteal artery plaque (n=14, magnification, ×100). Deep brown granular Cys C staining of foam cells in the lipid core and intimal layer as well as destruction of media was detected. (D) Statistical analyses of Cys C protein expression. Positive staining for Cys C in unstable plaque specimens was significantly higher than that in the stable plaque specimens. The results indicate the downregulation of Cys C expression in unstable plaques compared with stable plaques. *P<0.05 vs. Con; #P<0.05 vs. stable plaque group. Cys C, cystatin C; Cat K, cathepsin K; Con, control group; SP, stable plaque group; UP, unstable plaque group.
Primers and parameters of Cathepsin K and GAPDH for amplification.
Cathepsin K | GAPDH | |
---|---|---|
Forward (5′-3′) | CAGTGAAGAGGTGGTTCAGA | GGGTGATGCTGGTGCTGAGTATGT |
Reverse (5′-3′) | TTCCATCTCGGGGTCTGAGA | AAGAATGGGTGTTGCTGTTGAAGTC |
Fragment length (bps) | 109 | 617 |
Cycles | 94°C, 30 sec; 52°C, 30 sec; 72°C, 30 sec; 30 cycles | 94°C, 30 sec; 57°C, 30 sec; 72°C, 30 sec; 28 cycles |
Final extension | 72°C 10 min | 72°C 10 min |