ETM Experimental and Therapeutic Medicine 1792-0981 1792-1015 D.A. Spandidos 10.3892/etm.2017.4957 ETM-0-0-4957 Articles Expression of glutathione S-transferase A1, a phase II drug-metabolizing enzyme in acute hepatic injury on mice MaXin 1 LiuFangping 1 LiMinmin 1 LiZhi 1 LinYuexia 1 LiRui 1 LiChangwen 2 ChangYicong 1 ZhaoChangwei 1 HanQing 1 ZhouQiong 1 ZhaoYulin 1 WangDening 1 LiuJingli 2 College of Veterinary Medicine, Northeast Agricultural University, Harbin, Heilongjiang 150030, P.R. China Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin, Heilongjiang 150069, P.R. China Correspondence to: Professor Fangping Liu, College of Veterinary Medicine, Northeast Agriculture University, 59 Mucai Street, Harbin, Heilongjiang 150030, P.R. China, E-mail: fangpingliu@126.com 10 2017 17 08 2017 14 4 3798 3804 12102015 10032017 Copyright © 2017, Spandidos Publications 2017

In the present study, three models of acute liver injury in mice were induced via the administration of CCl4 (35 mg/kg, 24 h), acetyl-para-aminophenol (APAP; 200 mg/kg, 12 h) and ethanol (14 ml/kg, 8 h) to study the effect of glutathione S-transferase A1 (GSTA1) on acute liver injury. The serum levels of alanine transaminase, aspartate transaminase and liver homogenate indicators (superoxide dismutase, glutathione and glutathione peroxidase) were significantly lower in model groups compared with the control group (P<0.01), whereas the liver homogenate indicator malondialdehyde was significantly increased (P<0.01). The expression of GSTA1 in liver was significantly decreased in the model groups compared with the control group (P<0.01). GSTA1 protein content was 3.8, 1.3 and 2.6 times lower in the CCl4, APAP and ethanol model groups, respectively. Furthermore, GSTA1 mRNA expression levels decreased by 4.9, 2.1 and 3.7 times in the CCl4, APAP and ethanol model groups, respectively. Among the three models, the injury induced by CCl4 was the most marked, followed by ethanol and finally APAP. These results suggest that GSTA1 may be released by the liver and serve as an antioxidant in the prevention of liver damage.

 glutathione S-transferase A1 acute hepatic injury content mRNA expression antioxidant Introduction

Liver disease poses a serious threat to human health and food safety, as consumption of animals with liver disease may be detrimental to health (1). Acute liver injury is the common pathway and initiating factor of many liver diseases, such as acute liver failure (2). Three models of liver injury are typically used in research as they are representational and reflect the situation of hepatotoxicity comprehensively and intuitively (3). CCl4 is a classical hepatotoxicant, which is able to induce reactive oxygen formation and deplete glutathione (GSH) (4). Acetyl-para-aminophenol (APAP) hepatotoxicity is induced by the electrophile N-acetyl-p-benzoquinoneimine (NAPQI), which is able to induce mitochondrial dysfunction and oxidative stress, leading to liver damage (5). The major etiological factors of hepatotoxicity in ethanol-induced hepatic injury are oxidative stress and inflammatory responses (6). Due to the complexity of liver function and the diversity of liver damage factors, experimental animal models are not able to accurately and fully reflect the nature of liver injury (7). Furthermore, existing animal models have various limitations such as non-standardized methods, lack of reproducibility and non-unified methods (8).

Glutathione S-transferases (GSTs) are enzymes that are able to protect cells from damage caused by reactive oxygen species (9). GSTA (α class GST) serves an important cytoprotective role in detoxifying reactive electrophiles and products of lipid peroxidation (10). GSTs including GSTA have previously been identified as inhibitors of stress-activated kinase activity, most notably c-Jun N-terminal kinase (11). This suggests that altered GST expression may be an important factor in modulating the cellular transition between proliferation, differentiation, and apoptosis, as well as in the pathogenesis of various inflammatory, degenerative and neoplastic diseases.

GSTA1 is a member of the α family GST gene superfamily. In human and rat liver cells, the dominant GST activity and content is GSTA, which is encoded by a gene cluster located on chromosome 6p12 (12). GSTA1 may be used as an indicator of hepatic injury in chronic hepatitis C, low platelet syndrome cystic fibrosis or liver transplant patients (13). Furthermore, GSTA1 serves as a crucial role in the GSH binding reaction. In normal liver and kidney tissues, GSTA1-encoded dimeric protein expression is high and serves an important role in the anti-oxidative defense system (14). It is able to catalyze many xenobiotics, such as carcinogens, environmental toxins and certain pharmacological agents, by combining with GSH to promote the degradation of these substances (15).

Previous studies have reported that GSTA1 is important for the early diagnosis and treatment of liver injury (16). The present study evaluated the expression of GSTA1 in acute liver injury, and explored the importance of GSTA1 variation between liver injury models. The aim of the present study was to elucidate the protective effects and the molecular mechanisms of GSTA1 to provide a foundation for future investigations of hepatoprotective agents.

 Materials and methods <sec> <title>Reagents

CCl4 and ethanol were purchased from the third Chemical Industry (Shanghai, China). APAP was purchased from Shanghai Aladdin Biochem Technology Co., Ltd. (Shanghai, China). Detection kits for alanine transaminase (ALT; cat. no. C009-1), aspartate aminotransferase (AST; cat. no. C010-1), superoxide dismutase (SOD; cat. no. A001-1), malondialdehyde (MDA; cat. no. A003-1), GSH (cat. no. A006-1) and GSH peroxidase (GSH-Px; cat. no. A005) were purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The GSTA1 ELISA kit (cat. no. DRE30790) was purchased from RapidBio Systems, Inc. (Tucson, AZ, USA). TRIzol reagent was purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). PrimeScript™ RT reagent kit was purchased from Takara Bio Inc. (Otsu, Japan). For quantitative polymerase chain reaction (qPCR), the TransStart Top Green qPCR SuperMix kit was purchased from Beijing TransGen Biotech Co., Ltd. (Beijing, China).

 Animals and treatment

A total of 412 8-week-old male Kunming mice (18–22 g), were purchased from the Harbin Pharmaceutical Group Co., Ltd. General Pharm. Factory Laboratory Animal Centre Harbin, China). Mice were raised in controlled conditions at 20±2°C, 12 h light/dark cycle, 40–60% relative humidity and given ad libitum access to food and water, and were acclimated to laboratory conditions for at least 1 week prior to the experiment. All procedures where mice were used complied with the China National Institutes of Healthy Guidelines for the Care and Use of Laboratory Animals. All animal experimental procedures were approved by the Ethical and Animal Welfare Committee of Heilongjiang Province, China. Mice were divided into three cohorts for the optimal dose test, optimal time test and the replication of acute hepatic injury model experiments.

 Establishment of acute hepatic injury models Optimal dose tests

A total of 136 mice were used to establish the optimal dose. The mice were randomly divided into five CCl4 model groups, six APAP model groups and six ethanol model groups (n=8 in each). All animals were fasted for 16 h prior to experiments. Mice in the CCl4 dose groups were administered with 12.5, 25, 35 or 50 mg/kg CCl4, or an equal volume of bean oil as a control. The APAP groups were administered with 1% (100 mg/kg), 1.5% (150 mg/kg), 2% (200 mg/kg), 2.5% (250 mg/kg) or 3% (300 mg/kg) APAP, or an equal volume of physiological saline as a control. Ethanol groups were administered with 10, 12, 14, 16 or 18 ml/kg ethanol, or an equal volume of physiological saline as a control. At the end of the experiment, mice were anesthetized with ether (Shenyang Chemical Reagent Factory, Shenyang, China) and sacrificed by cervical dislocation and serum was collected to detect transaminases.

 Optimal time tests

A total of 176 mice were used to establish the optimal time. The mice were randomly divided into ten CCl4 model groups, six APAP model groups and six ethanol model groups (n=8 in each). All mice were fasted for 16 h prior to experiments. Experimental groups were treated with CCl4 (35 mg/kg), APAP (200 mg/kg) and ethanol (14 ml/kg) respectively, whereas control groups were given equal volume of solvent (bean oil or physiological saline). Mice were anesthetized with ether and sacrificed by cervical dislocation at 2, 6, 12, 16, 20, 24, 28, 32 and 48 h for the CCl4 model, at 4, 8, 12, 16 and 20 h for the APAP model and at 4, 6, 8, 10 and 12 h for the ethanol model, and serum was collected.

 Replication of acute hepatic injury models

A total of 60 mice were randomly divided into two groups for each model (CCl4, APAP and ethanol; n=10 in each group). The results of the optimal dose and optimal time tests were used to replicate three liver injury models. Mice were subsequently anesthetized with ether (Shenyang Chemical Reagent Factory) and sacrificed by cervical dislocation, following which serum and liver were harvested.

Of the mice, 40 were randomly divided into four groups (CCl4, APAP, ethanol and control; n=10 in each group). The results of the optimal dose and optimal time tests were used to replicate three liver injury models. Mice were subsequently anesthetized with ether and sacrificed by cervical dislocation, following which livers were harvested to detect GSTA1.

 Serum ALT and AST measurement

ALT and AST activities in mice serum were tested using detection kits according to the manufacturer's protocol.

 Liver homogenate indicators measurement

The livers were prepared as homogenate using a homogenizer (Automatic Sample Quick Grinding Machine, Tissue lyser-24; Shanghai Industrial Development Co., Ltd, Shanghai, China), then SOD, MDA, GSH, GSH-Px were measured using detection kits according to the manufacturer's protocol.

 Histopathological analysis

Liver tissues of mice were fixed in 10% formalin at room temperature for 24–48 h, embedded in paraffin and sectioned at 5 µm thickness. Tissues were subsequently stained with hematoxylin and eosin, observed under a light microscope (magnification, ×400) and images were captured.

 GSTA1 content detection

GSTA1 content in liver homogenate was detected using a mouse GSTA1 ELISA kit. The procedure was performed according to the manufacturer's protocol. The resultant color intensity (assessed using the generated standard curve) was proportional to the amount of GSTA1 in the sample.

 Detection of GSTA1 mRNA expression by RT-qPCR

Total RNA was prepared from 50–100 mg of liver tissue using TRIzol reagent according to the manufacturer's protocol. Isolated RNA (1 µg/20 µl reaction volume) was used for first-strand cDNA synthesis using the PrimeScript™ RT reagent kit. The PCR products were separated by gel electrophoresis on 1% (w/v) agarose gels. qPCR studies were performed using an ABI PRISM 7500 Detection System (Applied Biosystems, ; Thermo Fisher Scientific, Inc.). qPCR reaction was carried out with a total reaction volume of 20 µl containing 10 µl SYBR Premix Ex Taq, 0.4 µl ROX Reference Dye and 5 µM of each primer. Thermocycling conditions were as follows: 94°C for 5 min and then 40 cycles of 94°C for 30 sec, 58°C for 40 sec and 72°C for 40 sec, and a final extension step at 72°C for 5 min. The mRNA levels were normalized against β-actin mRNA. The results are expressed using the 2−∆∆Cq method (17). Primer sequences are listed in Table I.

 Statistical analysis

All numerical data are expressed as the mean ± standard deviation. Statistical significance was determined using SPSS 19.0 (IBM SPSS, Armonk, NY, USA). Tukey's test for multiple comparisons was used to determine statistical significance. P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Optimal dose and time tests Liver injury induced by CCl<sub>4</sub>

The results of liver injury induced by CCl4 are presented in Fig. 1. Serum levels of ALT and AST increased with CCl4 administration in a dose-dependent manner. Mice treated with 25 mg/kg CCl4 had significantly higher serum levels of ALT (P<0.05), whereas a significant increase in serum ALT and AST was observed in mice treated with 35 and 50 mg/kg CCl4 compared with the control mice (both P<0.01). Serum levels of both ALT and AST reached a peak at 24 h following CCl4 administration. Based on these results, 35 mg/kg CCl4 for 24 h was selected as the optimal model.

 Liver injury induced by APAP

The results of liver injury induced by APAP are presented in Fig. 2. Serum levels of ALT and AST increased following APAP administration in a dose-dependent manner. Serum levels of AST and ALT were significantly higher in mice treated with 150 (P<0.05), 200 and 250 mg/kg APAP (both P<0.01) compared with the control mice. Significant increases in serum levels of ALT and AST were observed from 8–20 h compared with control mice (all P<0.01). Serum levels of both ALT and AST peaked at 12 h. Based on these results 200 mg/kg APAP for 12 h was selected as the optimal model.

 Liver injury induced by ethanol

The results of liver injury induced by ethanol are presented in Fig. 3. Serum levels of ALT and AST increased following ethanol administration in a dose-dependent manner. Serum levels of AST were significantly higher in mice treated with 12 ml/kg ethanol (P<0.05), whereas ALT and AST levels were significantly increased with 14, 16 and 18 ml/kg ethanol (all P<0.01) compared with control mice. ALT and AST levels significantly increased at 8 h (P<0.01), and subsequently decreased. Based on these results, 14 ml/kg ethanol for 8 h was selected as the optimal model.

 Replication of acute hepatic injury models Liver injury model induced by CCl<sub>4</sub>

The results of CCl4 liver injury model replication are presented in Table II. A significant increase in serum ALT and AST was observed in the CCl4 model group (35 mg/kg; 24 h) compared with the control group (both P<0.01). Furthermore, mice in the CCl4 model group were found to have significantly lower levels of SOD, GSH and GSH-Px (all P<0.01) and significantly higher levels of MDA (P<0.01) compared with the control group.

 Liver injury model induced by APAP

The results of APAP liver injury model replication are presented in Table III. A significant increase in serum ALT and AST was observed in the APAP model group (200 mg/kg; 12 h) compared with the control group (both P<0.01). Furthermore, mice in the APAP model group were found to have significantly lower serum levels of SOD, GSH and GSH-Px (P<0.01) and significantly higher serum levels of MDA (P<0.01) compared with the control group.

 Liver injury model induced by ethanol

The results of ethanol liver injury model replication are presented in Table IV. A significant increase in serum ALT and AST was observed in the ethanol model group (14 ml/kg; 8 h) compared with the control group (P<0.01). Furthermore, mice in the ethanol model group were found to have significantly lower levels of SOD, GSH and GSH-Px (P<0.01) and significantly higher levels of MDA (P<0.01) compared with the control group.

 Histopathological analysis

Pathological section results of each group are presented in Fig. 4. Histopathological analysis revealed blurred hepatic lobular boundaries, hepatic cord disorders, hepatocellular degeneration, cell swelling and inflammatory cell infiltration in the CCl4-induced model. Central venous congestion, hepatic cord disorder, hepatocyte nucleus staining and hepatocellular necrosis were observed in the APAP-induced model. Hepatocellular hemorrhage, necrosis and inflammatory cell infiltration were observed in the ethanol-induced model.

 GSTA1 content in liver

The GSTA1 content of liver homogenates from hepatic injury models are presented in Fig. 5A. Liver GSTA1 content was significantly decreased (P<0.01) in all model groups compared with controls. In the CCl4 model, GSTA1 content was reduced from 16.21 to 4.28 ng/ml, a 3.8-fold decrease compared with the control group. In the APAP model, GSTA1 content reduced from 16.21 to 12.14 ng/ml, a 1.3-fold decrease compared with the control group. In the ethanol model, GSTA1 content reduced from 16.21 to 6.25 ng/ml, a 2.6-fold decrease compared with the control group.

 mRNA expression of GSTA1 in liver

GSTA1 mRNA expressions in acute hepatic injury models are presented in Fig. 5B. Gel electrophoresis revealed the PCR amplification fragments of GSTA1 gene and β-actin gene, and the degree of injury was determined depending on the strength of the signal (Fig. 5C). The mRNA expression of GSTA1 in the liver significantly decreased in all model groups compared with controls (all P<0.01; Fig. 5B). In the CCl4 model, GSTA1 mRNA expression reduced from 1.32 to 0.27, a 4.9-fold decrease compared with the control group. In the APAP model, GSTA1 mRNA expression levels were reduced from 1.32 to 0.62, a 2.1-fold decrease compared with controls. In the ethanol model, GSTA1 mRNA expression levels were reduced from 1.32 to 0.36, a 3.7-fold decrease.

 Discussion

In the present study, the optimal dose tests of CCl4, APAP and ethanol models of hepatic injury revealed that the degree of injury is dose dependent. Excessive doses are able to cause irreversible liver damage (18). The optimal administered dose was determined according to the minimum dose that was able to significantly increase ALT and AST levels in the serum. In exposure time tests, the levels of ALT and AST first increased and gradually decreased after reaching a peak. This may be associated with repair of the immune system. The difference between ALT and AST may be due to the different half-life (19).

ALT and AST levels in serum and histopathological changes in liver tissues are typically used to assess toxicity in experimental settings (20). Serum transaminase levels do not accurately reflect the degree of injury to liver function (21). Evaluations of the acute hepatic injury models should ideally use liver homogenate indicators, as they demonstrate changes in important factors associated with liver injury, such as oxidative stress (MDA) (22), antioxidant enzymes (SOD) (23), non-enzymatic antioxidant (GSH) (24) and selenium-containing enzymes (GSH-Px). The results of the optimal tests suggested that the experimental conditions (exposure dose and time) were appropriate to establish the acute hepatic injury models.

In all three models, the protein and mRNA expressions of GSTA1 were significantly decreased and the change in GSTA1 expression was consistent with the content in the liver. The results indicated the importance of GSTA1 in liver injury. GSTA1 serves an important role in hepatic injury, which is gradually being recognized (24). In the CCl4 model, the GSTA1 protein content and mRNA expression significantly decreased, and the decrease was the greatest of the three models. The results suggest that liver cells release large amounts of GSTA1 to serve an antioxidant role and protect the liver when damaged (25). Liver cells release large amounts GSTAl to scavenge free radicals when facing oxidative stress so that the body's redox balance is maintained (26).

APAP-induced acute hepatic injury is typically caused by intermediate NAPQI, which may lead to the depletion of GSH (27). GSH is the substrate of an enzymatic reaction catalyzed by GSTA1 (28); therefore, GSTA1 may theoretically reflect the degree of liver damage. In the APAP model, the protein content and mRNA expression of GSTA1 significantly decreased in accordance with previous predictions that GSTA1 is affected byAPAP-induced hepatic injury (29). The significant decrease of GSTA1 suggests that it maybe released as an antioxidant to protect the liver from various hepatotoxins. The potential reason is that the injury primarily affected the central lobuli hepatis where GSTA1 is abundant and can be released easily, thus the variation of GSTA1 is relatively more sensitive (30).

GST levels may be used as an indicator of hepatic damage in the alcoholic liver (31). Because GSTA1 is a major component of GST, and increasing GST levels is will affect GSTA1 (32). In the ethanol model, GSTA1mRNA and protein levels significantly decreased, which was consistent with other oxidation index changes. The half-life of GSTA1 is about 1 h (33), suggesting that it may be a useful marker of hepatocellular injury (34). A previous study by the present authors demonstrated that GSTA1 is more sensitive and is able to be detected earlier than ALT (16); therefore, increasing GSTA1 content in liver is an important mechanism leading to the hepatoprotective effect.

Of the models used in the present study, the injury induced by CCl4 was the most marked, followed by ethanol and finally APAP. The change of GSTA1 expression was positively correlated with its content. GSTA1 levels in all acute hepatic injury models were found to be significantly different from controls, which indicates that GSTA1 may serve a role in eliminating chemical mutagens and lipid peroxides. A previous study suggested that GSTA1 functions to remove toxic substances and carcinogens to protect the liver and prevent tumor formation (35).

In conclusion, the results of the present study suggest that GSTA1 in the liver may be released as an antioxidant to protect against liver injury. This research may serve as a foundation for further investigations into the regulatory role of hepatoprotective agents such as GSTA1 and the molecular mechanisms of GSTA1 regulation.

 Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 31472241), the Application Technology Research and Development Projects in Heilongjiang Province of China (grant no. PC13S03), and the Northeast Agricultural University Innovation Foundation For Postgraduate (grant no. yjscx14014).

 References AntoineDJDearJWLewisPSPlattVCoyleJMassonMThanacoodyRHGrayAJWebbDJMoggsJGMechanistic biomarkers provide early and sensitive detection of acetaminophen-induced acute liver injury at first presentation to hospitalHepatology58777787201310.1002/hep.26294 ReubenAKochDGLeeWMAcute Liver Failure Study Group: Drug-induced acute liver failure: Results of a U.S. multicenter, prospective studyHepatology5220652076201010.1002/hep.23937 ParkSWLeeCHKimYSKangSSJeonSJSonKHLeeSMProtective effect of baicalin against carbon tetrachloride-induced acute hepatic injury in miceJ Pharmacol Sci106136143200810.1254/jphs.FP0071392 TalwarSJaganiHVNayakPGKumarNKishoreABansalPShenoyRRNandakumarKToxicological evaluation of Terminalia paniculata bark extract and its protective effect against CCl4-induced liver injury in rodentsBMC Complement Altern Med13127201310.1186/1472-6882-13-127 JaeschkeHWilliamsCDMcGillMRXieYRamachandranAModels of drug-induced liver injury for evaluation of phytotherapeutics and other natural productsFood Chem Toxicol55279289201310.1016/j.fct.2012.12.063 WuDCederbaumAIAlcohol, oxidative stress, and free radical damageAlcohol Res Health272772842003 HozumiHTadaRMurakamiTAdachiYOhnoNComparative analysis of hepatic CD14 expression between two different endotoxin shock model mice: Relation between hepatic injury and CD14 expressionPloS One8e53692201310.1371/journal.pone.0053692 LiongECXiaoJLauTYNanjiAATipoeGLCyclooxygenase inhibitors protect D-galactosamine/lipopolysaccharide induced acute hepatic injury in experimental mice modelFood Chem Toxicol50861866201210.1016/j.fct.2011.11.009 FrovaCGlutathione transferases in the genomics era: New insights and perspectivesBiomol Eng23149169200610.1016/j.bioeng.2006.05.020 StrangeRCSpiteriMARamachandranSFryerAAGlutathione-S-transferase family of enzymesMutat Res4822126200110.1016/S0027-5107(01)00206-8 FadhelZAAmranSEffects of black tea extract on carbon tetrachloride-induced lipid peroxidation in liver, kidneys, and testes of ratsPhytother Res1SupplS28S32200210.1002/ptr.793 PrabhuKSReddyPVJonesECLikenADReddyCCChrarcterization of a class alpha glutathione-S-transgerase with glutathione peroxidase acticity in human liver microsomesArch Biochem Biophys4247280200410.1016/j.abb.2004.02.002 GianniniERissoDCeppaPBottaFChiarbonelloBFasoliAMalfattiFRomagnoliPLantieriPBTestaRUtility of alpha-glutathione S-transferase assessment in chronic hepatitis C patients with near normal alanine aminotransferase levelsClin Biochem33297301200010.1016/S0009-9120(00)00080-1 SuvakovSDamjanovicTStefanovicAPekmezovicTSavic-RadojevicAPljesa-ErcegovacMMaticMDjukicTCoricVJakovljevicJGlutathione S-transferase A1, M1, P1 and T1 null or low-activity genotypes are associated with enhanced oxidative damage among haemodialysis patientsNephrol Dial Transplant28202212201310.1093/ndt/gfs369 RazaHDual localization of glutathione S-transferase in the cytosol and mitochondria: Implications in oxidative stress, toxicity and diseaseFEBS J27842434251201110.1111/j.1742-4658.2011.08358.x LiuFLinYLiZMaXHanQLiuYZhouQLiuJLiRLiJGaoLGlutathione S-transferase A1 (GSTA1) release, an early indicator of acute hepatic injury in miceFood Chem Toxicol71225230201410.1016/j.fct.2014.06.011 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-tie quantitative PCR and the 2(−Delta Delta C(T)) MethodMethods25402408200110.1006/meth.2001.1262 FanGTangJJBhadauriaMNiralaSKDaiFZhouBLiYLiuZLResveratrol ameliorates carbon tetrachloride-induced acute liver injury in miceEnviron Toxicol Pharmacol28350356200910.1016/j.etap.2009.05.013 SheaTBRogersEAshlineDOrtizDSheuMSApolipoprotein E deficiency promotes increased oxidative stress and compensatory increases in antioxidants in brain tissueFree Radic Biol Med3311151120200210.1016/S0891-5849(02)01001-8 van BeekJHde MoorMHde GeusEJLubkeGHVinkJMWillemsenGBoomsmaDIThe genetic architecture of liver enzyme levels: GGT, ALT and ASTBehav Genet43329339201310.1007/s10519-013-9593-y MochizukiSKawashitaYEguchiSTakatsukiMYamanouchiKTokaiHHidakaMSoyamaANagayoshiSKanematsuTLiver repopulation by transplanted hepatocytes in a rat model of acute liver failure induced by carbon tetrachloride and a partial hepatectomyAnn Transplant1549552010 LykkesfeldtJMalondialdehyde as biomarker of oxidative damage to lipids caused by smokingClin Chim Acta3805058200710.1016/j.cca.2007.01.028 LiGChenJBWangCXuZNieHQinXYChenXMGongQCurcumin protects against acetaminophen-induced apoptosis in hepatic injuryWorld J Gastroenterol1974407446201310.3748/wjg.v19.i42.7440 ImaiHNarashimaKAraiMSakamotoHChibaNNakagawaYSuppression of leukotriene formation in RBL-2H3 cells that overexpressed phospholipid hydroperoxide glutathione peroxidaseJ Biol Chem27319901997199810.1074/jbc.273.4.1990 KarahalilBYağarSOzinYRelease of alpha-glutathione S-transferase (alpha-GST) and hepatocellular damage induced by helicobacter pylori and eradication treatmentCurr Drug Saf24346200710.2174/157488607779315426 LiangFQAlssadiRMoreheadPAwasthiYCGodleyBFEnhanced expression of glutathione-S-transferase A1-1 protects against oxidative stress in human retinal pigment epithelial cellsExp Eye Res80113119200510.1016/j.exer.2004.08.017 KnightTRKurtzABajtMLHinsonJAJaeschkeHVascular and hepatocellular peroxynitrite formation during acetaminophen-induced liver injury: Role of mitochondrial oxidant stressToxicol Sci62212220200110.1093/toxsci/62.2.212 LoguereioCFedericoAOxidative stress in viral and alcoholic hepatitisFree Radie Biol Med34l102003 SilvantoMMunsterhjelmESavolainenSTiainenPNiemiTYlikorkalaOScheininHOlkkolaKTEffect of 3 g of intravenous paracetamol on post-operative analgesia, platelet function and liver enzymes in patients undergoing tonsillectomy under local anaesthesiaActa Anaesthesiol Scand5111471154200710.1111/j.1399-6576.2007.01376.x HeijneWHSlittALvan BladerenPJGrotenJPKlaassenCDStierumRHvan OmmenBBromobenzene-induced hepatotoxicity at the transcriptome levelToxicol Sci79411422200410.1093/toxsci/kfh128 PolimantiRPiacentiniSFuciarelliMHapMap-based study of human soluble glutathione S-transferase enzymes: The role of natural selection in shaping the single nucleotide polymorphism diversity of xenobiotic-metabolizing genesPharmacogenet Genomics10665672201110.1097/FPC.0b013e328349da4d OakleyAGlutathione transferases: A structural perspectiveDrug Metab Rev43138151201110.3109/03602532.2011.558093 TrullAKFaceySPReesGWWightDGNoble-JamiesonGJoughinCFriendPJAlexanderGJSerum alpha-glutathione S-transferase-a sensitive marker of hepatocellular damage associated with acute liver allograft rejectionTransplantation58134513511994 BeckettGJHayesJDGlutathione S-transferases: Biomedical applicationsAdv Clin Chem30281380199310.1016/S0065-2423(08)60198-5 ColesBFChenGKadlubarFFRadominska-PandyaAInterindividual variation and organ-specific patterns of glutathione S-transferase alpha, mu, and pi expression in gastrointestinal tract mucosa of normal individualsArch Biochem Biophys403270276200210.1016/S0003-9861(02)00226-6

(A) Serum levels of ALT and AST with administration of CCl4 (24 h) at various doses (0, 12.5, 25, 35 and 50 mg/kg) and (B) serum levels of ALT and AST at various times (0, 2, 6, 12, 16, 20, 24, 28, 32 and 48 h) following the administration of CCl4 (0.35%). Values are expressed as the mean ± standard deviation in each group (n=8). *P<0.05, **P<0.01 vs. control. ALT, alanine transaminase; AST, aspartate transaminase.

(A) Serum levels of ALT and AST with administration of APAP (12 h) at various doses (0, 100, 150, 200 and 250 mg/kg) and (B) the levels of serum ALT and AST at various times (0, 4, 8, 12, 16 and 20 h) following the administration of APAP (2%). Values are expressed as the mean ± standard deviation in each group (n=8). *P<0.05, **P<0.01 vs. control. ALT, alanine transaminase; AST, aspartate transaminase; APAP, acetyl-para-aminophenol.

Serum levels of ALT and AST with administration of ethanol (8 h) at various doses (0, 10, 12, 14, 16 and 18 ml/kg) and (B) serum levels of ALT and AST at various times (0, 4, 6, 8, 10 and 12 h) following the administration of ethanol (50%). Values are expressed as the mean ± standard deviation in each group (n=8). *P<0.05, **P<0.01 vs. control. ALT, alanine transaminase; AST, aspartate transaminase.

Hematoxylin and eosin staining of liver tissues in three models of liver injury (CCl4, APAP and ethanol) were evaluated. Magnification, ×400. APAP, acetyl-para-aminophenol.

Changes in GSTA1 (A) protein and (B) mRNA expression in liver homogenates from three acute hepatic injury models. (C) Electrophoresis of polymerase chain reaction product. Values expressed as the mean ± standard deviation in each group (n=10). *P<0.05, **P<0.01 vs. control. GSTA1, glutathione S-transferase A1; APAP, acetyl-para-aminophenol.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Name 5′ Forward Primer 3′ Reverse Primer
GSTA1 TGGGAATTTGATGTTTGACC CAGGGCTCTCTCCTTCATGT
β-actin AGCGTCCTGGTCTTGATGTCTGT GAGGTCCCAGGTAGATGGTGAAT

GSTA1, glutathione S-transferase A1.

Changes of ALT and AST in serum and SOD, MDA, GSH and GSH-Px in liver following CCl4-induced acute hepatic injury.

Group ALT (IU/l) AST (IU/l) SOD (U/mg) MDA (nmol/mg) GSH (µmol/g) GSH-Px (U/mg)
Control 39.10±6.96 56.22±9.58 78.59±10.55 5.12±0.83 8.98±1.91 311.49±46.55
Model 925.85±170.77a 650.79±127.85a 53.83±10.97a 8.65±2.73a 5.29±1.55a 221.11±36.48a

Values are expressed as the mean ± standard deviation in each group.

P<0.01 vs. control. ALT, alanine transaminase; AST, aspartate transaminase; SOD, superoxide dismutase; MDA, malondialdehyde; GSH, glutathione; Px, peroxidase.

Changes of ALT and AST in serum and SOD, MDA, GSH and GSH-Px in liver following acetyl-para-aminophenol-induced acute hepatic injury.

Group ALT (IU/l) AST (IU/l) SOD (U/mg) MDA (nmol/mg) GSH (µmol/g) GSH-Px (U/mg)
Control 50.45±6.55 60.26±10.85 88.64±15.10 8.31±0.53 12.98±2.01 283.24±29.11
Model 647.71±88.21a 495.82±79.45a 57.54±7.06a 10.41±1.97a 8.37±1.44a 205.44±37.91a

Values expressed as the mean ± standard deviation in each group.

P<0.01 vs. control. ALT, alanine transaminase; AST, aspartate transaminase; SOD, superoxide dismutase; MDA, malondialdehyde; GSH, glutathione; Px, peroxidase.

Changes of ALT and AST in serum and SOD, MDA, GSH and GSH-Px in liver following ethanol-induced acute hepatic injury.

Group ALT (IU/l) AST (IU/l) SOD (U/mg) MDA (nmol/mg) GSH (µmol/g) GSH-Px (U/mg)
Control 34.99±6.37 52.77±7.08 58.87±7.64 7.13±0.83 16.68±3.94 319.06±45.51
Model 47.52±7.21a 94.14±16.95a 44.81±6.69a 10.12±1.36a 9.35±1.01a 193.16±38.84a

Values expressed as the mean ± standard deviation in each group.

P<0.01 vs. control. ALT, alanine transaminase; AST, aspartate transaminase; SOD, superoxide dismutase; MDA, malondialdehyde; GSH, glutathione; Px, peroxidase.