Two human cervical carcinoma cell lines, Hela and SiHa, which exhibit relatively low metastatic capability, were obtained from the China Center for Type Culture Collection (Wuhan, China). Cells were all cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) in an atmosphere of 5% CO₂ and 95% air. SiHa and HeLa cells were plated in 6-well plates.

Total RNA was extracted from 1×10⁶ human SiHa and HeLa cells using TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA). Aliquots (1 g) of RNA were reverse transcribed to cDNA and aliquots (4 μl) of cDNA were used as a template for qPCR using an ABI7900HT PCR system (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer’s instructions. The primers were as follows: Forward: 5′-TGGAGAGAAACTGAAGAAATCG-3′ and reverse 5′-GTACCTGAATTTGTTGTTGAGC-3′ for iNOS; forward: 5′-GCTGTGAAGCCAGACAGC-3′ and reverse: 5′-GGCAAGTCACCCTGCTGA-3′ for VEGF; and forward: 5′-CTCCATCCTGGCCTCGCTGT-3′ and reverse: 5′-GCTGTCACCTTCACCGTTCC-3′ for β-actin (ACTB). All experiments were performed in triplicate, with each reading taken three times. Average and standard deviations were subsequently calculated.

A nuclear extraction kit (Chemicon International, Temecula, CA, USA) was used to isolate cytoplasmic proteins. Proteins, 50 μg, from various groups were boiled for 5 min in sample buffer and were subsequently separated in sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) (10–15%) and transferred onto a polyvinylidene fluoride (PVDF) membrane (Bio-Rad Laboratories, Hercules, CA, USA). Nonspecific reactivity was blocked using 5% bovine serum albumin in a Tris-buffered saline (TBS) with Tween-20 buffer (100 ml 10% TBS, 10 ml 10% Tween-20 final 0.1% v/v, dissolved with 890 ml double distilled-H₂O) and subsequently incubated with primary antibody mouse anti-VEGF (sc-1836, 1:200), rabbit anti-iNOS (sc-650, 1:200) or rabbit anti-actin (sc-130656, 1:500) antibodies (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4°C and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Santa Cruz Biotechnology). Bands were detected using the Supersignal West Dura Extended Duration Substrate (Pierce, Rockford, IL, USA), and quantified using the Chemi-doc gel quantification system (Bio-Rad). All data were normalized to β-actin. Western blotting experiments were repeated at least twice in order to confirm the results.

The quantity of VEGF released was measured by a sandwich ELISA. ELISA plates (Cat. No: 655001; Greiner, Bio-One, Frickenhausen, Germany) were coated with 100 μl of 2 μg/ml anti-VEGF165 (R&D Systems, Minneapolis, MN, USA) antibody in phosphate-buffered saline (PBS) for 12 h at 4°C. The plates were washed with PBS containing 0.1% Tween 20 (TPBS) and incubated for 1 h at 25°C with 200 μl/well of 1% bovine serum albumin (Sigma-Aldrich, St. Louis, MO, USA) in PBS. The conditioned medium, or various concentrations of recombinant human VEGF, were incubated for 2 h at 25°C and washed four times with TPBS. Following incubation for 2 h at 25°C with 100 μl of 0.2 μg/ml biotinylated anti-VEGF antibody, the plates were washed and incubated for a further 45 min with 100 μl HRP-conjugated streptavidin (Vector Laboratories, Burlingame, CA, USA). After washing, the plates were developed by adding 50 μl tetramethylbenzidine (Sigma-Aldrich) and the reaction was stopped by adding 50 μl 2NH₂SO₄. The absorbance at 450 nm was measured with a Tecan 96-well plate reader (Tecan, Untersbergstrasse, Austria). The NO level was detected by supernatant absorbance at 540 nm, according to the Griess method (11).

Cell proliferation assays were performed with cell counting kit-8 (CCK-8; Dojindo, Kumamoto, Japan). SiHa and HeLa cells treated with nonsense sequence (SCR) or lentiviruses expressing iNOS-targeted shRNA (iNOS-SH) were seeded into 96-well plates at 5×10³ per well in a 100 μl cell culture medium and maintained at 37°C in a humidified incubator containing 5% CO₂ for 24 h. One hundred microlitres of 2% FBS medium was used as a control. After 96 cultures, 10 μl CCK-8 solution was added to the triplicate wells and incubated for 3 h. Subsequently, the absorbance at 450 nm was measured in order to calculate the number of vital cells in each well. Cell proliferation is represented as the mean percentage ± standard deviation of absorbance. Cell apoptosis assays were performed by flow cytometry with propidium iodide (PI) and Annexin V-fluorescein isothiocyanate (FITC) once the cells had been digested with trypsin, washed and harvested.

iNOS-SH shRNA was generated from two different annealed oligonucleotides (target 1: 5′-CCGGCCAGAAGCAGAATGTGACATCTC GAGTGGTCACATTCTGCTTCTGGTTTTTG-3′ and 5′-AATTCAAAAACCAGAAGCAGAATGTGACATCTCGA GATGGTCACATTCTGCTTCTGG-3′; target 2: 5′-CCGGGAAGCGGTAACAAAGGAGATACTCGAGTATC TCCTTTGTTACCGCTTCTTTTTG-3′ and 5′-AATTCAAAAAGAAGCGGTAACAAAGGAGATACTCGAG TATCTCCTTTGTTACCGCTTC-3′; and target 3: 5′-CCGGCGAGGACTATTTCTTTCAGCTCTCGAGAGCT GAAAGAAATAGTCCTCGTTTTTG-3′ and 5′-AA TTCAAAAACGAGGACTATTTCTTTCAGCTCTCGAGAGCT GAAAGAAATAGTCCTCG-3′) that were inserted into the AgeI and EcoRI sites of SCR vector purchased from Addgene; the human iNOS target sequence is underlined. The control shRNA was purchased from Addgene. All target sequences were designed and verified as specific for iNOS by Blast searching against the human genome. The resulting plasmids, iNOS-SH1, iNOS-SH2 and iNOS-SH3, were sequence-verified.

To obtain a recombinant lentivirus, HEK-293T cells were cotransfected with the package, envelope and iNOS-SH constructs. The virus-containing supernatant was harvested following 60 h cotransfection and concentrated by ultracentrifugation at 100,000 × g for 2 h with an Avanti J-30I (Beckman Coulter, Miami, FL, USA). For infection, the viral stock was supplemented with 8 μg/ml polybrene.

All studies involving animals were approved by the Ethics Committee of Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China). Five- to six-week-old female athymic BALB/c nude mice were purchased from Sino-British Sippr/BK Lab Animal Ltd, Co. (Shanghai, China). iNOS-SH and SCR-infected HeLa cells (1×10⁶) were suspended in 100 μl PBS and were subcutaneously injected into the posterior flank of 4–5 week-old female nude mice. Tumor size measurement was performed every three days over the course of 4 weeks and the tumor volume was estimated using the formula: Volume = length × width² × 0.5. The comparison of tumor volumes between the iNOS-SH and vehicle control groups was performed using paired t-tests.

Tissues were fixed in 10% buffered formalin fixative at room temperature overnight. Samples were subsequently deparaffinized in xylene, rehydrated through graded ethanol, quenched for endogenous peroxidase activity in 0.3% hydrogen peroxide and processed for antigen retrieval by microwave heating in 10 mM citrate buffer (pH 6.0) using antibodies against iNOS, VEGF, and myeloperoxidase (MPO) (Dako, Carpinteria, CA, USA). Immunostaining was performed according to the manufacturer’s instructions using the ChemMate Dako EnVision Detection kit, Peroxidase/DAB, Rabbit/Mouse (DakoCytomation, Glostrup, Denmark), which resulted in a brown precipitate at the antigen site.

All results are expressed as the mean ± standard error of the mean. Differences were analyzed by Student’s t-test with SPSS 15.0 software, (SPSS, Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

In order to determine the function of iNOS in the development of cervical cancer, a number of SiHa and HeLa cells were not infected or infected with lentiviruses expressing a 20 base fragment of human shRNA and control scramble, respectively. The efficacy of this fragment in inhibiting the expression of iNOS in these cell lines was determined by western blotting, and SH3 was selected as the iNOS shRNA of the three shRNAs for its high knockdown efficiency (Fig. 1A). According to the results of western blotting and qPCR, the iNOS protein product from the SiHa and HeLa cells was significantly different between the experimental and control groups following iNOS stable knockdown (P<0.05). In cells expressing iNOS-shRNA, there was significant inhibition of iNOS expression (60% mRNA knockdown in SiHa cells, and 75% mRNA knockdown in HeLa cells; >70% protein knockdown efficacy in the two cell lines) (Fig. 1).

To test the function of iNOS in cervical cancer growth, cell proliferation was investigated following iNOS knockdown. As expected, the number of SiHa and HeLa cells decreased markedly under iNOS-SH downregulation, compared with the blank and scramble groups (Fig. 2A and B). However, data from flow cytometry revealed a statistically significant increase in the levels of SiHa and HeLa apoptosis (Fig. 2C and D). The experimental evidence reveals the critical role of iNOS in SiHa and HeLa growth in vitro. In contrast to their growth in vitro, when SiHa and HeLa cells were inoculated into the flanks of nude mice, the iNOS-SH HeLa cells growth rate in vivo was significantly slower compared with that of the control cells (Fig. 3A and B). Tumors derived from iNOS-SH SiHa cells exhibited a growth rate similar to that of iNOS-SH HeLa tumors. HeLa tumors became palpable and measurable 10 days after cell inoculation compared with SiHa tumors, which could be measured 13 days following inoculation. Following 20 days of growth, the mean tumor size of HeLa tumors was half that of the control tumors. Inhibition of iNOS expression in HeLa tumors was confirmed by IHC analysis iNOS (Fig. 3C and D) and VEGF (Fig. 3E and F) of tumors with or without iNOS knockdown.

NO has been demonstrated to stimulate and inhibit VEGF expression in a cell-dependent manner and is a potent modulator of vascular development and tumor progression. In in vitro studies, the iNOS-shRNA group demonstrated that the two cell lines produced lower levels of VEGF compared with the control group. The inhibition of iNOS with lentivirus-based-RNAi for 24 h resulted in a significant 1.5-fold downregulation of NO in the supernatant of SiHa and HeLa cell lines (Fig. 4A and B). Furthermore, the concentration of VEGF in the same supernatant was markedly reduced in the iNOS-shRNA group, compared with the control group, as determined by western blotting (Fig. 4C and D).

To assess whether NO is a mediator for the reduction of VEGF in the supernatant and iNOS-SH treated cells, sodium nitroprusside (SN), an exogenous NO donor, was applied to stimulate cells. The mRNA level of iNOS and VEGF in cells incubated in media with or without SN (DMSO, 0.25, 0.5 and 1 mM) were assessed (Fig. 5A and B). In all groups, the VEGF mRNA level (Fig. 5B) demonstrated a significant increase with treatment with a high concentration of SN (0.5 mM), without changing the iNOS level, which may mimic the effect of iNOS. However, in SiHa and HeLa cells, SN increased the supernatant concentration of NO in a dose-dependent manner. The fact that SN increased the supernatant concentration of NO in iNOS-SH SiHa and HeLa cells reveals that SN induced NO production in an iNOS-independent way (Fig. 5C and D). Furthermore, in SiHa and HeLa cells the stable knockdown of iNOS-SH, the protein levels of VEGF and iNOS peaked at 0.5 mM SN treatment, but exhibited a smaller increase with 1 mM SN (Fig. 5E and F).

In conclusion, the data indicated that the knockdown of iNOS based on depressed lentivirus proliferation of SiHa and HeLa, may be mimicked by applying an extrogenous NO donor. Furthermore, iNOS is capable of regulating the proliferation of cervical cancer cells and the expression of VEGF by regulating the concentration of NO.