Recent studies have shown that DNA methylation in the promoter of microRNA-375 (miR-375) downregulates its expression during tumorigenesis. However, it is not known if CpG methylation of the miR-375 promoter also has a role in the pathogenesis of type 2 diabetes mellitus (T2DM). In this study, the expression level and CpG methylation status of miR-375 in patients with T2DM were analyzed. Plasma samples from 100 patients with T2DM and 100 healthy controls with normal glucose tolerance (NGT) were collected. The plasma levels of miR-375 were examined using quantitative polymerase chain reaction (qPCR) and the methylation status of 17 CpG sites in the promoter of the miR-375 were determined using MassARRAY spectrometry. The plasma levels of miR-375 were found to be upregulated in patients with T2DM compared with controls with NGT (P<0.05). Overall, the methylation levels of the miR-375 promoter in patients with T2DM were not significantly different compared with controls with NGT; however, further studies revealed that four of the eight analyzed individual CpG units within the amplicon were significantly hypomethylated in T2DM samples compared with the NGT samples. This study demonstrated for the first time, to the best of our knowledge, that miR-375 is overexpressed in plasma in patients with T2DM, and this may be used as a novel biomarker to distinguish between patients with T2DM and healthy individuals. It was also demonstrated in this study that the miR-375 promoter is hypomethylated, in patients with T2DM, which may regulate the expression of miR-375 and contribute to the pathogenesis of T2DM.
miR-375type 2 diabetesmethylationIntroduction
Type 2 diabetes mellitus (T2DM) is a complex polygenic disease, commonly resulting from defects in insulin secretion and diminished sensitivity of target tissues to insulin (1). β-cell dysfunction is a fundamental characteristic of T2DM development, and it leads to quantitative and qualitative abnormalities in insulin secretion, abnormalities in the kinetics of insulin secretion and progression of the defects with time (2).
MicroRNAs (miRNAs) are endogenous small non-coding RNAs (~22 nucleotides), which are involved in post-transcriptional control of gene expression (3). They directly control the expression of a large portion of the human genome and are involved in the regulation of major cellular activities, including metabolism, differentiation, proliferation and apoptosis (4,5). miRNAs have been suggested to have a role in multiple human diseases (6) and increasing evidence has shown that miRNAs are also involved in the pathogenesis of metabolic diseases, including diabetes mellitus. Previous studies have revealed that miRNAs, including miR-375, miR-9 and miR-124a, are important regulators of specialized β-cell functions (7–10). It has been shown that miR-375, a pancreatic islet-specific miRNA, regulates insulin secretion through direct inhibition of insulin exocytosis (7). High levels of miR-375 are found in the pancreatic islet of obese (ob/ob) mice and have been shown to regulate glucose homeostasis (8). One study demonstrated that upregulated pancreatic miR-375 is a useful biomarker for pathways in the pathogenesis of T2DM associated with islet amyloid deposition and β-cell deficit (11). These findings suggest that miR-375 regulates the function of β cells in T2DM, but the exact role of miRNA-375 in T2DM has yet to be elucidated.
Previous studies have also investigated the role of epigenetics in the pathogenesis of T2DM (12,13). Epigenetic modifications, particularly DNA hypermethylation, have been found to have a role in the regulation of genes important for protection against T2DM. miR-375 is encoded in the intergenic region and has an independent promoter containing CpG islands, which provides a basis for the regulation of its expression by methylation. Therefore, it was hypothesized that aberrant methylation of the human miR-375 promoter may lead to abnormal expression, thereby causing β-cell dysfunction, and ultimately participate in the pathogenesis of the T2DM. This has already been previously demonstrated in certain types of cancer (14–16).
In China, the Kazak population has a significantly higher proportion of overweight individuals and a higher incidence of insulin resistance and hypertension compared with the Han population (17). Furthermore, the Kazak population are known to consume more meat and fewer vegetables than the Han population. However, the prevalence of T2DM in the Kazak population is only 3.65%, which is lower compared with the Han population in the same region (17). This suggests that the Kazak population may have a unique genetic background, and was the basis for the investigations in this study. It was hypothesized that the expression level and CpG methylation status of miR-375 may be important in the incidence and severity of T2DM. The changes in miR-375 expression level and the quantitative methylation status of CpG within the miR-375 promoter were assessed to determine whether aberrant promoter methylation of miR-375 was present in patients with T2DM. The findings may lead to the identification of a novel biomarker for the diagnosis of T2DM.
Materials and methodsSubjects
This study was prospectively performed and approved by the Institutional Ethics Committees of the First Affiliated Hospital of Shihezi University School of Medicine (Shihezi, Xinjiang, China) and conducted in accordance with the ethical guidelines of the Declaration of Helsinki. Written informed consent was obtained from all individuals prior to the start of the study. Individuals of Chinese Kazak origin with T2DM (n=100) and healthy controls with normal glucose tolerance (NGT; n=100) were recruited from the Department of Endocrinology and Metabolism at the First Affiliated Hospital of Shihezi University School of Medicine between 2010 and 2011. Diagnosis of T2DM was based on the World Health Organization criteria as fasting glucose levels ≥7 mmol/l (126 mg/dl), 2 h oral glucose tolerance test glucose levels ≥11.1 mmol/l (200 mg/dl) or clinical diagnosis of the disease. Patients with T2DM (54 male and 46 female; mean age, 51.33±11.75 years) were recruited when they were hospitalized for treatment for poor glycemic control. Individuals who came for a health checkup in the hospital were recruited as healthy controls (44 male and 56 female; mean age, 48.55±12.41 years). Any individuals who may have had an infectious disease prior to or during the recruitment were excluded from this study, as well as patients with autoimmune diseases.
Nucleic acid isolation
RNAs were isolated from peripheral plasma samples from patients with T2DM and controls with NGT using the miRNeasy Mini kit 50 (Qiagen, Hilden, Germany) and genomic DNA was isolated from peripheral plasma using the DNeasy Blood and Tissue kit (Qiagen) in accordance with the manufacturer’s instructions. The RNA and DNA were quantified by measuring their absorption at 260 nm (Toption Instrument Co., Ltd., Xi’an, China).
Reverse transcription and quantitative polymerase chain reaction (qPCR)
The TaqMan® microRNA Reverse Transcription kit (Applied Biosystems®, Foster City, CA, USA) was used for complementary DNA synthesis. For reverse transcription, 10 μl TaqMan Universal PCR Master Mix (Applied Biosystems) and 5 μl total RNA were reverse transcribed at 16ºC for 30 min, 42ºC for 30 min, and 85ºC for 5 min. miR-375 expression was quantified in triplicate using qPCR using the ABI Prism 7300 Sequence Detection System (Applied Biosystems). Taqman primers and probes for the target gene miR-375 and the internal control miRNA-16, which is often used as a normalization control for microRNAs, were obtained from Applied Biosystems. PCR was performed under the following conditions: 50ºC for 2 min then 95ºC for 10 min, followed by 40 cycles at 95ºC for 15 sec and 60ºC for 1 min. miRNA-16 was used as an internal control to normalize the expression level of each sample. The comparative threshold cycle (Ct) method was used to evaluate the relative abundance of miR-16 compared with U6 expression (fold changes relative to miRNA-16).
Analysis of methylation
To quantify the levels of methylation of the CpG islands in the miR-375 promoter, the high-throughput MassARRAY platform (Sequenom Inc., San Diego, CA, USA) was used as previously described (18). Briefly, bisulfite-treated DNA was amplified using primers for the miR-375 CpG island. The primers were designed using EpiDesigner (Sequenom Inc.) and were as follows: forward 5′-aggaagagagGGGTGGAGTATTTTTGTTTGTTG-3′ and reverse 5′-cagtaatacgactcactatagggagaaggct AAAAACATAATCCAAAACATCCT AAT-3′. The PCR products were spotted on a 384-pad SpectroCHIP (Sequenom Inc.), followed by spectral acquisition on a MassARRAY Analyzer. Methylation data of the individual units (1–3 CpG sites/unit) were generated using the EpiTyper version 1.0.5 software (Sequenom Inc.).
Statistical analysis
The differences in miR-375 CpG methylation between patients with T2DM and controls with NGT were assessed using the Mann-Whitney and Kruskal-Wallis tests. The distances between CpG methylation sites to transcription start sites were calculated using the RMySQL package and the SQL database version of the University of California Santa Cruz (UCSC) genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway). Two-dimensional clustering was performed with the heatmap.2 function in the gregmisc package using the R statistical environment. Classical multidimensional scaling was performed using the cmdscale function and visualization was conducted through the scatter plot3d function in the gregmisc package. A Student’s t-test, a Wilcox test or a Fisher’s exact test was utilized to compare the qPCR results in different groups with standard function in R statistical environment. P<0.05 was considered to indicate a statistically significant difference.
ResultsCharacteristics of the subjects
A total of 100 patients with T2DM and 100 age-matched healthy controls with NGT participated in this study. The clinical characteristics of the subjects are shown in Table I. The average age was 51.33±11.75 years for patients with T2DM and 48.55±12.41 years for controls with NGT. As expected, the patients with T2DM had a higher body mass index (BMI), waist-to-hip ratio (WHR), systolic blood pressure (SBP), fasting plasma glucose (FPG), low-density lipoprotein cholesterol (LDL-C), total cholesterol (TC) and triglyceride (TG) and lower high-density lipoprotein cholesterol (HDL-cholesterol) compared with controls with NGT.
Upregulation of miR-375 expression in patients with T2DM compared with controls with NGT
It has previously been demonstrated that miR-375 expression is lost in different types of cancer (15,16); therefore it was investigated in this study whether aberrant expression of miR-375 was present in the patients with T2DM. qPCR was performed to determine the expression levels of miR-375 mRNA in T2DM plasma samples and corresponding NGT samples. As shown in Fig. 1, the level of miR-375 mRNA was significantly upregulated in T2DM samples compared with the NGT samples (P=0.0313).
Specific CpG hypomethylation of the miR-375 promoter may contribute to its overexpression in patients with T2DM
In order to understand the mechanism of miR-375 upregulation, the methylation status of the promoter region of miR-375 was investigated. To determine whether the methylation status was correlated with the upregulation of miR-375, T2DM and corresponding NGT samples were analyzed using MassARRAY EpiTyper. Hierarchical clustering identified substantial differences in the quantitative methylation profiling of T2DM samples compared with controls (Fig. 2).
A schematic representation of the promoter region of miR-375 according to UCSC Genome Browser’s CpG island annotations and miRbase release 13.0 is shown in Fig. 3. Methylation was present from −990 to −1,258 bp relative to the transcription start site of miR-375 in T2DM samples. Eight CpG units (comprising a total of 17 CpG sites) spanning 267 bp in the specified promoter region of miR-375 were analyzed in 100 T2DM samples and 100 controls (a total of 31,248 sites in all analyzed samples). The overall methylation of the miR-375 promoter was found to be <10% for the T2DM and NGT samples; the mean levels of miR-375 methylation, calculated from the methylation levels of the 17 CpG residues, were 8.59% in the patients with T2DM and 8.97% in the control group with NGT (P=0.9582; Fig. 4). The levels of miR-375 promoter methylation varied between 4.6 and 15.3% in T2DM samples and between 3.0 and 17.9% in NGT samples.
Although no differences in overall methylation levels between control and T2DM samples were observed, hypomethylation of specific critical CpG units was investigated to determine whether they accounted for the increased miR-375 expression observed in T2DM samples. Analysis of the individual CpG units in T2DM samples and controls using MassARRAY EpiTyper revealed that six CpG units in this amplicon were hypomethylated, with the exception of CpG_7 and CpG_20. In addition, significant differences were observed in four specific CpG units, CpG_1.2, CpG_3.4, CpG_5.6 and CpG_21.22.23.34, which were hypomethylated in T2DM samples but not in NGT samples (Fig. 5).
Discussion
Previous studies have shown that expression levels of miR-375 have different effects in different types of cancer. For example, the upregulation of miR-375 stimulates cell proliferation in breast and prostate cancer (14,19); however, downregulation of miR-375 in gastric cancer leads to the activation of the phosphoinositide-dependent kinase 1-Akt (PDK1-Akt) and Janus kinase (JAK) oncogenic pathways (15,20). In this study, the expression pattern of miR-375 was investigated in patients with T2DM. It was found that the plasma level of miR-375 was significantly upregulated in T2DM samples compared with NGT samples (Fig. 1). It has previously been shown that overexpression of miR-375 downregulates the expression of myotrophin, a pivotal factor implicated in the regulation of a variety of genes responsible for cellular apoptosis and proliferation (21). Together, these observations suggest that miR-375 is involved in the pathogenesis of T2DM. Since plasma/serum miRNA levels are particularly stable, and the expression level of miRNAs in the serum is reproducible and consistent among individuals, a previous study investigated the presence of circulating miRNAs and their potential use as disease biomarkers (22). The results of the present study suggest that the plasma level of miR-375 may allow patients with T2DM to be distinguished from healthy controls, and, therefore, miR-375 may be used as a novel biomarker for T2DM.
Epigenetic modifications of DNA, such as methylation, have been suggested to have a key role in T2DM disease progression (12,13), and miRNA are epigenetically regulated by DNA methylation (23). Several studies had revealed that the expression of miR-375 is epigenetically regulated in oesophageal squamous cell carcinoma, as well as gastric and breast cancer (14–16); however, miR-375 promoter methylation has not been directly linked to T2DM. In the present study, it was investigated whether the upregulation of miR-375 was mediated by epigenetic mechanisms in patients with T2DM. Using MALDI-TOF MS, methylation patterns were evaluated at multiple CpG sites within the promoter regions of miR-375, and it was found that overall there was less methylation in T2DM samples compared with NGT samples, although this difference was not statistically significant (P>0.05) (Fig. 4). Since there is considerable variation between methylation levels of different CpG units, the methylation status of specific CpG units was further evaluated. The results revealed that there was a significant decrease in methylation in four specific CpG units in T2DM samples compared with NGT samples. These findings suggest that miR-375 CpG island hypomethylation may be negatively correlated with miR-375 expression. In addition, hypomethylation of miR-375 may be used to predict the progression of T2DM. miR-375 inhibits insulin secretion and decreases the number of β cells. miR-375 may also affect cell proliferation, differentiation and the expression of apoptosis-associated genes so as to promote the occurrence of apoptosis(15,16). Therefore, it was hypothesized that hypomethylation of the miR-375 gene promoter may be involved in the development of diabetes.
In this study, aberrant miR-375 expression and methylation were detected in the plasma of patients with T2DM. This has a potential clinical application for the identification of pateints with T2DM from individuals with NGT. Despite the small sample size, this is the first study, to the best of our knowledge, to report an alteration in the level of miR-375 in plasma of patients with T2DM. Clinical detection of upregulated miR-375 levels may not be limited to using plasma for T2DM diagnosis, and it may be interesting to investigate whether miR-375 is also present in other body fluids, for example saliva or urine, in order to establish a general diagnostic method.
In conclusion, it was demonstrated in this study that miR-375 expression was significantly upregulated and hypomethylation was found in four specific CpG units of the miR-375 promoter in patients with T2DM compared with controls with NGT. These results suggest that DNA methylation may have an important role in the control of T2DM. These results may also lead to the development of miRNA-based targeted approaches for the treatment of T2DM.
Acknowledgements
This study was supported by the National Natural Science Foundation of China (81060065/H0711).
ReferencesButlerAEJansonJBonner-WeirSRitzelRRizzaRAButlerPCBeta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetesDiabetes521021102003GuillausseauPJMeasTVirallyMLaloi-MichelinMMédeauVKevorkianJPAbnormalities in insulin secretion in type 2 diabetes mellitusDiabetes Metab34Suppl 2S43S482008AmbrosVThe functions of animal microRNAsNature4313503552004BartelDPMicroRNAs: target recognition and regulatory functionsCell1362152332009UhlmannSZhangJDSchwägerAMannspergerHRiazalhosseiniYBurmesterSmiR-200bc/429 cluster targets PLCgamma1 and differentially regulates proliferation and EGF-driven invasion than miR-200a/141 in breast cancerOncogene29429743062010ChangTCMendellJTmicroRNAs in vertebrate physiology and human diseaseAnnu Rev Genomics Hum Genet82152392007PoyMNEliassonLKrutzfeldtJKuwajimaSMaXMacdonaldPEA pancreatic islet-specific microRNA regulates insulin secretionNature4322262302004PoyMNHausserJTrajkovskiMBraunMCollinsSRorsmanPmiR-375 maintains normal pancreatic alpha- and beta-cell massProc Natl Acad Sci USA106581358182009BaroukhNRavierMALoderMKHillEVBounacerAScharfmannRMicroRNA-124a regulates Foxa2 expression and intracellular signaling in pancreatic beta-cell linesJ Biol Chem28219575195882007PlaisanceVAbderrahmaniAPerret-MenoudVJacqueminPLemaigreFRegazziRMicroRNA-9 controls the expression of Granuphilin/Slp4 and the secretory response of insulin-producing cellsJ Biol Chem28126932269422006ZhaoHGuanJLeeHMSuiYHeLSiuJJUp-regulated pancreatic tissue microRNA-375 associates with human type 2 diabetes through beta-cell deficit and islet amyloid depositionPancreas398438462010GardnerRJMackayDJMungallAJPolychronakosCSiebertRShieldJPAn imprinted locus associated with transient neonatal diabetes mellitusHum Mol Genet95895962000LingCDel GuerraSLupiRRönnTGranhallCLuthmanHEpigenetic regulation of PPARGC1A in human type 2 diabetic islets and effect on insulin secretionDiabetologia516156222008de Souza Rocha SimoniniPBreilingAGuptaNMalekpourMYounsMOmranipourREpigenetically deregulated microRNA-375 is involved in a positive feedback loop with estrogen receptor alpha in breast cancer cellsCancer Res70917591842010TsukamotoYNakadaCNoguchiTTanigawaMNguyenLTUchidaTMicroRNA-375 is downregulated in gastric carcinomas and regulates cell survival by targeting PDK1 and 14–3–3zetaCancer Res70233923492010KongKLKwongDLChanTHLawSYChenLLiYMicroRNA-375 inhibits tumour growth and metastasis in oesophageal squamous cell carcinoma through repressing insulin-like growth factor 1 receptorGut6133422012YangYNXieXMaYTLiXMFuZYMaXType 2 diabetes in Xinjiang Uygur Autonomous Region, ChinaPLoS One7e352702012LinHJZuoTLinCHKuoCTLiyanarachchiSSunSBreast cancer-associated fibroblasts confer AKT1-mediated epigenetic silencing of cystatin M in epithelial cellsCancer Res6810257102662008SzczyrbaJNolteEWachSKremmerEStöhrRHartmannADownregulation of Sec23A protein by miRNA-375 in prostate carcinomaMol Cancer Res97918002011DingLXuYZhangWDengYSiMDuYYaoHMiR-375 frequently downregulated in gastric cancer inhibits cell proliferation by targeting JAK2Cell Res207847932010LiYXuXLiangYLiuSXiaoHLiFmiR-375 enhances palmitate-induced lipoapoptosis in insulin-secreting NIT-1 cells by repressing myotrophin (V1) protein expressionInt J Clin Exp Pathol32542642010MitchellPSParkinRKKrohEMFritzBRWymanSKPogosova-AgadjanyanELCirculating microRNAs as stable blood-based markers for cancer detectionProc Natl Acad Sci USA10510513105182008WeberBStresemannCBruecknerBLykoFMethylation of human microRNA genes in normal and neoplastic cellsCell Cycle6100110052007
Levels of miR-375 expression in NGT and T2DM samples. Plasma mRNA levels of miR-375 in 100 patients with T2DM and 100 controls with NGT were determined using quantitative polymerase chain reaction (qPCR) as described in Materials and methods. The relative expression values were defined as the expression ratio of miR-375 to miR-16. The values are presented as the mean ± standard deviation (SD) from three independent experiments. The significance level was determined using a Student’s t-test between the the two groups and P<0.05 was considered to indicate a statistically significant difference. miR-375, microRNA-375; NGT, normal glucose tolerance; T2DM, type 2 diabetes mellitus.
Hierarchical clustering of miR-375 methylation profiles in T2DM samples and NGT controls. MassARRAY (Sequenom Inc., San Diego, CA, USA) analysis was used to quantify DNA methylation of miR-375 in T2DM samples and NGT controls. Each row represents a sample and each column represents a CpG unit, which consists of a single CpG site or a combination of CpG sites. miR-375, microRNA-375; T2DM, type 2 diabetes mellitus; NGT, normal glucose tolerance.
Schematic representation of the miR-375 promoter region. Vertical lines represent the CpG dinucleotides. The arrow indicates the transcriptional start site. The CpG island is represented by the gray box and the black-filled bars represents the MassARRAY-studied amplicon regions. Amplicon characteristics are shown beneath the black bars. bp, base pair; TSS, transcriptional start site; miR-375, microRNA-375.
DNA methylation levels of miR-375 promoters in the samples from patients with T2DM and NGT controls. MassARRAY (Sequenom Inc., San Diego, CA, USA) was used to determine the overall methylation levels. The mean methylation level of the 17 CpG residues in the 100 samples was used to represent the promoter methylation levels. Data are presented as the mean ± standard deviation (SD). miR-375, microRNA-375; T2DM, type 2 diabetes mellitus; NGT, normal glucose tolerance.
Specific miR-375 CpG methylation in T2DM samples compared with NGT samples. The average methylation of specific CpG units of amplicon in 100 patients with T2DM and 100 controls with NGT was determined using MassARRAY EpiTyper (Sequenom Inc., San Diego, CA, USA). The values represent the mean ± standard error. Mann-Whitney and Kruskal-Wallis tests were used for the comparison between the two groups. ***P<0.001; *P<0.05, comparison between T2MD and NGT smaples. miR-375, microRNA-375; T2DM, type 2 diabetes mellitus; NGT, normal glucose tolerance.
Characteristics of the study subjects.
NGT
T2DM
P-value
Gender (male/female)
44/56
54/46
0.159
Age (years)
48.55±12.41
51.33±11.75
0.105
WHR
0.88±0.04
0.92±0.05
0.017
BMI (kg/m2)
24.44±4.63
26.30±4.08
0.005
SBP (mmHg)
129.90±23.72
141.46±17.89
<0.001
DBP (mmHg)
83.81±13.33
86.18±10.88
0.196
FPG (mmol/l)
4.10±0.64
10.60±4.27
<0.001
TC (mmol/l)
3.67±0.92
5.10±1.39
<0.001
TG (mmol/l)
1.02±0.69
1.90±1.42
<0.001
LDL-C (mmol/l)
1.73±0.58
2.86±1.03
<0.001
HDL-C (mmol/l)
1.33±0.45
1.10±0.24
<0.001
NGT, normal glucose tolerance; T2DM, type 2 diabetes mellitus; WHR, waist-to-hip ratio; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; FPG, fasting plasma glucose; TC, total cholesterol; TG, triglyceride; LDL-C, low-density lipoprotein cholesterol; HDL-cholesterol, high-density lipoprotein cholesterol.