Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2014.1964 mmr-09-04-1237 Articles Inhibitory effect of Lycium barbarum polysaccharides on cell apoptosis and senescence is potentially mediated by the p53 signaling pathway XIAGUANGQING1 XINNIAN2 LIUWEI1 YAOHUIMIN1 HOUYI2 QIJIE2 College of Life Science, Tonghua Normal University, Tonghua, Jilin 134002, P.R. China Key Laboratory of Marine Genetics and Breeding, Ocean University of China, Qingdao 266003, P.R. China Correspondence to: Dr Jie Qi, Key Laboratory of Marine Genetics and Breeding, Ocean University of China, 5 Yushan Road, Qingdao 266003, P.R. China, E-mail: qijie@ouc.edu.cn 4 2014 19 02 2014 9 4 1237 1241 17 09 2013 03 02 2014 Copyright © 2014, Spandidos Publications 2014 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed, reproduced, and reused for non-commercial purposes, provided the original source is properly cited.

Lycium barbarum (L. barbarum) fruit or extract has been regarded as a superior-grade Chinese medicine, used to modulate body immunity and for anti-aging purposes. However, the underlying molecular mechanisms behind these effects remain unclear. In the present study, L. barbarum polysaccharides (LBPs), considered a major contributor of L. barbarum effects, were used to elucidate its mechanism of action by phenotypic and senescence associated-β-galactosidase (SA-β-gal) assays, evaluation of survival rates in vivo and expression profiling of genes related to the p53 signaling pathway in a zebrafish model. Zebrafish embryos were continuously exposed to various concentrations of LBPs (1.0, 2.0, 3.0 and 4.0 mg/ml) for 3 days. The results of fluorescent acridine orange and SA-β-gal staining indicated that cell apoptosis and senescence mainly occur in the head at 24 hours post fertilization (hpf) and 72 hpf. In addition, resistance to replicative senescence was observed at low doses of LBPs, especially at the 3.0 mg/ml concentration. Furthermore, the expression of genes that relate to aging, such as p53, p21 and Bax, was decreased, while that of Mdm2 and TERT genes was increased after treatment with LBPs. The results demonstrated that the effects of LBPs on cell apoptosis and aging might be mediated by the p53-mediated pathway.

 cell apoptosis Lycium barbarum polysaccharides senescence zebrafish Introduction

Aging is defined as the accumulation of diverse deleterious changes in cells and tissues (1). It is commonly associated with a reduction in physiological functions, and is closely related to apoptosis. In biology, the state or process of aging is known as senescence. It occurs at the level of the organism (organismal senescence), as well as at the level of individual cells (cellular senescence). At the individual cell level there are two types of senescence, replicative and stress-induced premature senescence (SIPS). Genetic and environmental manipulations have revealed that aging is regulated by specific pathways, involved in hormonal signaling, nutrient sensing and signaling, mitochondria and ROS signaling and genome surveillance (2). However, the question of whether all these signaling pathways exert their effects separately, or involve one or more junction co-regulators among these signaling pathways in the aging process remains to be determined.

Chinese herbs have been widely applied in the field of medicine as anti-aging drugs because of their few side-effects (3,4). The plant species Lycium barbarum (L. barbarum) belongs to the family of Solanaceae, and its fruit or extract has been regarded in Chinese pharmacopoeia as a superior-grade medicine for the modulation of body immunity (5–7). The effects of L. barbarum are attributed to the polysaccharides (LBPs) it contains, which can upregulate both innate and adaptive immune responses (8,9). It has been shown that LBPs can protect neurons from β-amyloid peptide neurotoxicity (10,11), and from neuronal death, glial activation and oxidative stress in a murine retinal ischemia/reperfusion model (12,13).

The tumor suppressor gene p53 has been known to play an important role in the induction of cell cycle arrest and apoptosis (14). In a recent study, LBPs were found to stimulate the proliferation of MCF-7 cells via the ERK pathway, which may be associated with the p53 pathway (15). Although findings of previous studies have demonstrated the beneficial effects of LBPs on the health of humans and animals (16,17), to the best of our knowledge, there have been scarce studies that systematically investigate the signaling pathway(s) via which LBPs exert these beneficial effects, especially in zebrafish, an excellent model for studying angiogenesis, senescence, and toxicity responses (18–21). In this study, we examined senescence during the early development stages of zebrafish, cell apoptosis, and senescence-associated gene expression upon treatment with LBPs from the Chinese herb L. barbarum in the zebrafish model, in order to investigate the effects of this herb and identify the related signaling pathway(s) potentially involved in anti-aging processes.

 Materials and methods Materials and animals

Purified L. barbarum polysaccharides (LBPs) were purchased from Shanxi Undersun Biomedtech Co., Ltd. (Xi’an, Shaanxi, China) and an extract was prepared using the method of Luo et al (22). Zebrafish were maintained in standard fish facility conditions with a 14:10 h light/dark cycle and fed with living brine shrimp twice per day. The water temperature was maintained at 28°C. The study was approved by the ethics committee of Ocean University of China (Qingdao, China).

 Embryo treatment and image collection

Embryos at 8 hours post-fertilization (hpf) were placed into a 24-well microplate (Millipore Co., Bedford, MA, USA). Thirty embryos were continuously exposed to varying concentrations of LBPs (0, 1, 2, 3 and 4 mg/ml) for 3 days (d). LBPs were renewed daily. Each treatment with an LBP concentration was repeated three times and the standard deviation was calculated. To collect images of embryo phenotypes, treated and non-treated embryos were anesthetized with 0.2 mg/ml tricaine (3-aminobenzoic acid ethylester; Sigma-Aldrich, St. Louis, MO, USA) and embedded in methylcellulose.

 Senescence associated-β-galactosidase (SA-β-gal) assay

Embryos of 72 hpf were fixed in 4% paraformaldehyde in phosphate-buffered saline, at 4°C overnight. Staining of SA-β-gal and quantifications were performed according to the method of Kishi et al (23).

 In vivo detection of cell death

For the in vivo detection of cell death, 2 day-old embryos were incubated in 5 mg/ml acridine orange stain (AO; Sigma-Aldrich) in zebrafish embryo medium [NaCl, 5.03 mM; KCl, 0.17 mM; CaCl2·2H2O, 0.03 mM; MgSO4·7H2O, 0.03 mM; methylene blue, 0.1% (w/v)] and kept in the dark for 15–30 min at 28°C, then rinsed thoroughly 8 times with egg water. Stained embryos were anesthetized with MESAB (0.5 mM 3-aminobenzoic acid ethyl ester, 2 mM Na2HPO4) and mounted in a depression slide for observation using methylcellulose. They were then visualized using a fluorescence microscope (AZ100, Nikon, Tokyo, Japan) and images were captured for <60 sec (the signal is quenched after 60 sec of exposure to fluorescence). Embryos that were not stained with AO were used to determine baseline fluorescence.

 Semi-quantitative RT-PCR

Total RNA was extracted from 72 hpf embryos using the TRIzol reagent. Semi-quantitative PCR was performed with an initial incubation for 5 min at 94°C, followed by 22 cycles of incubation at 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec. The primers for amplification of p53 and p21 were the same as in (24): p53 forward/reverse: CTCTCCCACCAACATCCACT/ACGTCCACC ACCATTTGAAC; p21 forward/reverse: CGGAATAAA CGGTGTCGTCT/CGCAAACAGACCAACATCAC. The primers for amplification of Bax, Mdm2, TERT and β-actin were: Bax forward/reverse: GGAGATGAGCTGGAT GGAAAT/ATGACGTGCTCCTGAATGTAG; Mdm2 forward/reverse: GACTACTGGAAGTGTCCCAAAT/GTCCACTCCATCATCTGTTTCT; TERT forward/reverse: GTGTGTGTGTCCTGGGTAAA/CAGCCTGAGGTCTAA GAAGATG; β-actin forward/reverse: CCCAGACATCAG GGAGTGAT/TCTCTGTTGGCTTTGGATT. Subsequently, 10 μl PCR products were loaded into gels for agarose gel electrophoresis.

 Statistical analysis

Data are presented as mean ± SD (n=30). Differences between groups were assessed by analysis of variance (ANOVA) and Student’s t-tests. Statistical analyses was carried out using SPSS for Windows, Version 11.5 (SPSS Inc., Chicago, IL, USA).

 Results Zebrafish embryo bioassay for assessing the toxicity of LBPs

The dose of LBPs that was lethal for embryos was determined by incubating embryos in different concentrations of LBPs. The results indicated that the growth and development of embryos were significantly inhibited at the concentration of 4.0 mg/ml (Fig. 1A). The number of surviving embryos was not significantly different among the lower concentrations (0, 1, 2 and 3 mg/ml). Half of the embryos died in this experiment, and the embryos showed an abnormal phenotype (Fig. 1B and C) when treated with the highest concentration of LBPs tested in the present study (4 mg/ml).

 Assessing senescence in zebrafish embryos SA-β-gal staining

Cytochemically and histochemically detectable SA-β-gal at pH 6.0 has been shown to increase during the replicative senescence of cells in vitro and in tissue samples (25), and has subsequently been widely used as an in vivo and in vitro marker of cellular senescence in a number of vertebrate animal systems (26–28). To assess the effect of LBPs on replicative senescence, the SA-β-gal activity was histochemically detected at pH 6.0 in the 72 hpf embryos. The untreated embryos exhibited low background staining, especially in the head (Fig. 2A), while embryos treated with LBPs showed faint background staining, which was reduced with treatment with increased concentrations of LBPs (Fig. 2B–D). Only at the 4 mg/ml concentration were embryos more strongly stained compared to untreated ones and to those treated with 1–3 mg/ml LBPs (Fig. 2E). Quantification of SA-β-gal staining was performed using high-resolution digital imagery. SA-β-gal staining at 1, 2 and 3 mg/ml LBPs was estimated to correspond to 88.3, 81.7 and 68.3% of the staining observed in the control (treated with 0 mg/ml LBPs), while it was 112.7% of the control for the 4 mg/ml LBPs, as shown in Fig. 2F. The less amount of staining was equivalent to that of the less senescent mass.

 Acridine orange (AO) staining

To explore the effect of LBPs on apoptosis, AO staining was performed. Treatment with 1–3 mg/ml LBPs reduced cell apoptosis in a dose-dependent manner (Fig. 3A–D), while at the 4 mg/ml LBPs concentration, cell apoptosis was induced, as observed from the comparison to control animals and to those treated with lower LBPs concentrations (Fig. 3E). Embryos treated with 4 mg/ml LBPs showed high levels of AO staining (red arrowheads) in the brain and the neural tube, compared to non-treated embryos (Fig. 3A) at 24 hpf.

 The expression levels of genes related to the p53 signaling pathway after LBPs treatment

It was reported that in MCF-7 breast cancer cells, LBPs can activate ERK, which may be associated with the p53 signaling pathway (15). There is also the hypothesis that different types of intrinsic and extrinsic stress signals likely converge on the activation of the p53 protein, the Rb protein, or both during senescence (29). In this context, we examined whether zebrafish and mammals share similar mechanisms for the response to LBPs treatment. To further investigate p53-dependent transcriptional responses in the treated embryos, we examined the expression of p53, along with that of response genes such as p21, Mdm2 and Bax, using semi-quantitative RT-PCR and the β-actin gene as a control of baseline expression. The results showed that the expression level of p53, p21 and Bax were decreased in treated embryos compared to non-treated ones (Fig. 4A–C), while the levels of Mdm2 and even, that of the cellular senescence-related (30–32) telomerase reverse transcriptase (TERT), which allows to maintain the telomere ends, were increased (Fig. 4D and E).

 Discussion

L. barbarum fruits (berries) or extract have been widely used for centuries to balance the ‘Yin’ and the ‘Yang’ in the body (33). The major ingredient of the liquid fraction of these berries, LBPs, has been the object of research focus in studies aiming to identify anti-aging remedies (34) or agents alleviating cellular damage (12,35).

p53, as a central mediator of cellular responses induced in various processes including apoptosis (36), was shown to exert similar effects to ERK during stress induced by DNA damage (37). In MCF-7 cells, LBPs increased the activity of ERK (15). p21 as a regulator of cell cycle progression controlled by the tumor suppressor protein p53, inhibited tumor progression, thus preventing cell proliferation, while inducing cell apoptosis (38). In our study, cell apoptosis was inhibited following treatment with non-toxic doses of LBPs (1–3 mg/ml), as shown by AO staining, the reduced expression of p53 and the increased expression of its negative regulator, Mdm2. A potential explanation for these findings is that the cellular responses triggered by the activated p53 protein (cellular senescence) act as potent barriers against the effects of LBPs.

In this study, we assessed the relevance of one molecular mechanism potentially underlying the effect of LBPs on cellular senescence in a zebrafish model by phenotypic and SA-β-gal assays, in vivo detection of survival rates and expression profiling of genes that related to the p53 signaling pathway during senescence. Zebrafish senescence was alleviated by LBPs via inhibition of cell death and apoptosis in the early development, a reduction in the expression level of p53, p21 and Bax genes and an increase in the expression of Mdm2 and TERT genes. In conclusion, our findings suggest that the anti-aging effects of LBPs are mediated by the p53 signal pathway. The specific targets of LBPs in this pathway may be identified in future studies.

 Acknowledgements

This study was financially supported by a grant from the Jilin Provincial Science & Technology Department (no. 201215227).

 References HarmanDThe free radical theory of agingAntioxid Redox Signal55575612003 GreerELBrunetASignaling networks in agingJ Cell Sci1214074122008 BastianettoSQuirionRNatural extracts as possible protective agents of brain agingNeurobiol Aging238918972002 ChangIMAnti-aging and health-promoting constituents derived from traditional oriental herbal remedies: information retrieval using the TradiMed 2000 DBAnn NY Acad Sci9282812862001 GanLZhangSHLiuQXuHBA polysaccharide-protein complex from Lycium barbarum upregulates cytokine expression in human peripheral blood mononuclear cellsEur J Pharmacol4712172222003 LiXMMaYLLiuXJEffect of the Lycium barbarum polysaccharides on age-related oxidative stress in aged miceJ Ethnopharmacol1115045112007 ZhangMChenHHuangJLiZZhuCZhangSEffect of lycium barbarum polysaccharide on human hepatoma QGY7703 cells: inhibition of proliferation and induction of apoptosisLife Sci76211521242005 DuGLiuLFangJExperimental study on the enhancement of murine splenic lymphocyte proliferation by Lycium barbarum glycopeptideJ Huazhong Univ Sci Technolog Med Sci245185205272004 VidalKBenyacoubJSanchez-GarciaJIntake of a milk-based wolfberry formulation enhances the immune response of young-adult and aged miceRejuvenation Res1347532010 YuMSLaiCSHoYSCharacterization of the effects of anti-aging medicine Fructus lycii on beta-amyloid peptide neurotoxicityInt J Mol Med202612682007 YuMSLeungSKLaiSWNeuroprotective effects of anti-aging oriental medicine Lycium barbarum against beta-amyloid peptide neurotoxicityExp Gerontol407167272005 LiSYYangDYeungCMLycium barbarum polysaccharides reduce neuronal damage, blood-retinal barrier disruption and oxidative stress in retinal ischemia/reperfusion injuryPLoS One6e163802011 JinMHuangQZhaoKShangPBiological activities and potential health benefit effects of polysaccharides isolated from Lycium barbarum LInt J Biol Macromol5416232013 MayPMayETwenty years of p53 research: structural and functional aspects of the p53 proteinOncogene18762176361999 ShenLDuGLycium barbarum polysaccharide stimulates proliferation of MCF-7 cells by the ERK pathwayLife Sci913533572012 KellerETMurthaJMThe use of mature zebrafish (Danio rerio) as a model for human aging and diseaseComp Biochem Physiol C Toxicol Pharmacol1383353412004 TsaiSBTucciVUchiyamaJDifferential effects of genotoxic stress on both concurrent body growth and gradual senescence in the adult zebrafishAging Cell62092242007 ParngCSengWLSeminoCMcGrathPZebrafish: a preclinical model for drug screeningAssay Drug Dev Technol141482002 GerhardGSKauffmanEJWangXLife spans and senescent phenotypes in two strains of zebrafish (Danio rerio)Exp Gerontol37105510682002 HerreraMJagadeeswaranPAnnual fish as a genetic model for agingJ Gerontol A Biol Sci Med Sci591011072004 GranatoMNusslein-VolhardCFishing for genes controlling developmentCurr Opin Genet Dev64614681996 LuoQCaiYYanJSunMCorkeHHypoglycemic and hypolipidemic effects and antioxidant activity of fruit extracts from Lycium barbarumLife Sci761371492004 KishiSBaylissPEUchiyamaJThe identification of zebrafish mutants showing alterations in senescence-associated biomarkersPLoS Genet4e10001522008 RobuMELarsonJDNaseviciusAp53 activation by knockdown technologiesPLoS Genet3e782007 DimriGPLeeXBasileGA biomarker that identifies senescent human cells in culture and in aging skin in vivoProc Natl Acad Sci USA92936393671995 CaoLLiWKimSBrodieSGDengCXSenescence, aging, and malignant transformation mediated by p53 in mice lacking the Brca1 full-length isoformGenes Dev172012132003 KeyesWMWuYVogelHGuoXLoweSWMillsAAp63 deficiency activates a program of cellular senescence and leads to accelerated agingGenes Dev19198619992005 IkegamiRZhangJRivera-BennettsAKYagerTDActivation of the metaphase checkpoint and an apoptosis programme in the early zebrafish embryo, by treatment with the spindle-destabilising agent nocodazoleZygote53293501997 Ben-PorathIWeinbergRAWhen cells get stressed: an integrative view of cellular senescenceJ Clin Invest1138132004 ConcettiFLucariniNCarpiFMThe functional VNTR MNS16A of the TERT gene is associated with human longevity in a population of Central ItalyExp Gerontol485875922013 JaskelioffMMullerFLPaikJHTelomerase reactivation reverses tissue degeneration in aged telomerase-deficient miceNature4691021062011 WyllieFSJonesCJSkinnerJWTelomerase prevents the accelerated cell ageing of Werner syndrome fibroblastsNat Genet2416172000 ChangRCSoKFUse of anti-aging herbal medicine, Lycium barbarum, against aging-associated diseases. What do we know so far?Cell Mol Neurobiol286436522008 PotteratOGoji (Lycium barbarum and L. chinense): Phytochemistry, pharmacology and safety in the perspective of traditional uses and recent popularityPlanta Med767192010 YangDLiSYYeungCMLycium barbarum extracts protect the brain from blood-brain barrier disruption and cerebral edema in experimental strokePLoS One7e335962012 KoivusaloRKrauszERuotsalainenPHeleniusHHietanenSChemoradiation of cervical cancer cells: targeting human papillomavirus E6 and p53 leads to either augmented or attenuated apoptosis depending on the platinum carrier ligandCancer Res62736473712002 SinghSUpadhyayAKAjayAKBhatMKp53 regulates ERK activation in carboplatin induced apoptosis in cervical carcinoma: a novel target of p53 in apoptosisFEBS Lett5812892952007 Gomez-ManzanoCFueyoJKyritsisAPCharacterization of p53 and p21 functional interactions in glioma cells en route to apoptosisJ Natl Cancer Inst89103610441997

Effect of Lycium barbarum polysaccharides (LBPs) on the growth and development of zebrafish embryos at 48 hours post-fertilization (hpf). (A) The percentage of surviving embryos after treatment with different doses of LBPs. Data are presented as mean ± SD (n=30). (B) Phenotype of 48 hpf embryos not treated with LBPs and (C) treated with 4 mg/ml LBPs.

Senescence associated-β-galactosidase (SA-β-gal) activity changes in 72-hour post fertilization (hpf) embryos treated with Lycium barbarum polysaccharides (LBPs). Phenotype of (A) non-treated and (B–E) treated embryos with 1, 2, 3 and 4 mg/ml of LBPs, respectively. (F) Relative intensities of SA-β-gal staining expressed as pixels from computer scanning analysis. **P<0.05 vs. (0 mg/ml); **P<0.01 vs. control (0 mg/ml).

Representative cellular death phenotypes detected at 24 hours post-fertilization (hpf). (A–E) Microscopic images of acridine orange (AO) staining on embryos treated with 0, 1, 2, 3 and 4 mg/ml of Lycium barbarum polysaccharides (LBPs), respectively. Quantitative analysis revealed that apoptosis decreased in a dose-dependent manner and that the 4 mg/ml concentration of LBPs induced cell apoptosis. Red arrowheads denote the main areas of positive staining.

Expression profiles of key genes related to senescence at 72 hours post fertilization (hpf) in zebrafish treated with 3 mg/ml Lycium barbarum polysaccharides (LBPs) and in non-treated animals (uninjected). (A–C) The expression levels of genes encoding the regulatory protein p53, the cell cycle checkpoint protein p21 and the apoptotic- and senescence-related protein Bax respectively, increased upon treatment with LBPs, while those of genes encoding the (D–E) p53 regulator Mdm2 and the apoptotic- and senescence-related protein TERT decreased. (F) β-actin was used as a control of baseline expression.