Written informed consent was obtained from all participating subjects and the present study was approved by the ethics committee of the Fourth Military Medical University (Xi’an, China). Bone marrow aspirates of 5–10 ml from the iliac crest were obtained from five normal donors and four elderly osteoporotic patients who had undergone an iliac bone graft procedure during surgery. Normal donors had a T-score of >-1 standard deviation (SD) and no history of bone fractures. A standardized clinical evaluation was performed to exclude possible comorbidities. Exclusion criteria included premature menopause, the presence of a disease and the use of drugs that are able to affect bone or calcium and phosphorus metabolism. Osteoporosis was diagnosed in accordance with the World Health Organization parameters, with a T-score of <-2.5 SD. Calcium, phosphate, parathyroid hormone, carboxy-terminal telopeptide of type I collagen, alkaline phosphatase (ALP), 25-hydroxyvitamin D levels and the urinary calcium excretion rate were measured in the serum of all elderly patients with osteoporotic fractures to exclude any secondary causes of osteoporosis.

hBMSCs were isolated and cultured as previously described (15). Bone marrow aspirates of 5–10 ml were placed in tubes containing heparin (100 U/l) and were mixed with isochoric phosphate-buffered saline (PBS). The cell suspension was mixed with an equal volume (1.073 g/ml) of Percoll solution (Pharmacia, Uppsala, Sweden) in 15 ml conical tubes (Nunc A/S, Roskilde, Denmark) and centrifuged (L500 Centrifuge; Xiangyi Centrifuge Instrument Co., Ltd., Hunan, China) at 644.8 × g for 30 min. Mononuclear cells were collected from the middle layer and interface, diluted with two volumes of PBS and collected by centrifugation at 161.2 × g. The cells were resuspended in complete culture medium (low-glucose Dulbecco’s modified Eagle medium with 10% fetal bovine serum, 100 U/ml penicillin, 100 mg/ml streptomycin and 2 mM L-glutamine; Hyclone, Logan, UT, USA). The cells were seeded at 4,500 cells/cm² in 25 cm² culture flasks (Nunc A/S) and were incubated at 37°C in 5% CO₂ with 95% humidity. After three days of incubation, the cultured medium and non-adherent cells were discarded, adherent cells were washed twice with PBS and resuspended in fresh culture medium. After 10–14 days of culture, the cells were harvested using 0.25% trypsin and 1 mM EDTA (Gibco, Grand Island, NY, USA) and were replated at 10⁴ cells/cm² in 25 cm² culture flasks (Nunc A/S) to expand the cells through successive passages.

For osteogenic differentiation, hBMSCs were seeded at 10⁴ cells/cm² in 25 cm² culture flasks (for RNA isolation; Nunc A/S) or in six-well plates (for staining). Cells were grown to 45–75% confluency over 24–48 h in standard growth medium. On every third day, the medium was replaced with osteogenic differentiation medium (10% fetal bovine serum, Hyclone; 100 nM dexamethasone, 45 mM L-ascorbic acid and 10 mM β-glycerophosphate; Sigma, St. Louis, MO, USA). Samples were stained or harvested for RNA isolation on the 14th day of differentiation.

The miR-125b mimic, miR-125b inhibitor and a non-specific negative control (NC) were designed and synthesized by Invitrogen Life Technologies (Shanghai, China). The sequences included: miR-125b mimic, 5′-UCCCUGAGACCCUAACUUGUGAA CAAGUUAGGGUCUCAGGGAUU-3′; miR-125b inhibitor, 5′-UCACAAGUUAGGGUCUCAGGGA-3′ and NC, 5′-CAG UACUUUUGUGUAGUACAA-3′.

The negative control, a random sequenced anti-miRNA molecule based on the miRNAs in C. elegans, has been extensively compared to the human, mouse and rat genome sequences and miRNA sequences by the Basic Logarithmic Alignment Search Tool for nucleotides (BLASTn; National Library of Medicine, Bethesda, MD, USA) and validated to not produce identifiable effects on the known miRNA functions.

Cells were transfected using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). The hBMSCs were plated in six-well plates (Nunc A/S) to 45% confluence. In addition, 20 μM miR-125b mimic or a miR-125b inhibitor were mixed with Lipofectamine 2000, which was prepared according to the manufacturer’s instructions. The final concentrations of miR-125b mimic or miR-125b inhibitor and the negative control were adjusted to 45 nM. The culture conditions were conducive and the survival rate of hBMSCs was up to 90% following transfection. After the transfection (4 h), the medium was replaced with osteogenic differentiation medium to induce osteoblast differentiation.

Total RNA was isolated from cultured cells using TRIzol^® reagent (Invitrogen), according to the manufacturer’s instructions. The integrity and purity of total RNA was verified spectrophotometrically and by gel-electrophoresis on formaldehyde denaturation gel.

Gene expression levels were measured by the iQ5 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). microRNAs were prepared with an All-in-One™ miRNA qRT-PCR detection kit (AOMD-Q020; GeneCopoeia, Inc., Rockville, MD, USA) according to the manufacturer’s instructions. Briefly, the extracted RNA was reverse-transcribed in the presence of a poly-A polymerase with an oligo-dT adaptor. qPCR was then performed with SYBR^® Green (Takara, Shiga, Japan) detection with a forward primer for the mature miRNA sequence and a universal adaptor reverse primer. RNA was reverse-transcribed using the All-in-One™ miRNA qPCR Primer (GeneCopoeia, Inc.).

The sequence of the F-Primer for human snRNA U6 was: TCGTGAAGCGTTCCATATTTTTAA. The sequence of the F-Primer for Homo sapiens (hsa)-miR-125b was: CCCTGAGACCCTAACTTGTGAAA and the sequence of the Mature1_Seq for hsa-miR-125b was: UCCCUGAGACCCUAACUUGUGA. The expression of Runx-2, ALP, Osteocalcin (OC), collagen type I α1 (COL1α1) and Osx were quantified by qPCR using SYBR^® Green assays (Takara) and GAPDH was used as an internal control.

PCR primers included: Runx-2 forward, CCACCACTCAC TACCACACCTA and reverse, CCTGACGAAGTGCC ATAGTAGA; ALP forward, GCATAACATCAGGGACAT TGAC and reverse, TGGCTTTCTCGTCACTCTCAT; OC forward, CTCACACTCCTCGCCCTATT and reverse, CG CTGGGTCTCTTCACTAC; COL1α1 forward, AGGGCT CCAACGAGATCGAGATCCG and reverse, TACAG GAAGCAGACAGGGCCAACG; Osx forward, ACCTACCC ATCTGACTTTGCTC and reverse, CTGCCCACTATTTCC CACTG; GAPDH forward, GGAGACAACCTGGTCCTCAG and reverse, CTCTGTCTCTCTGACCTCACAG.

The Ct value obtained for the gene of interest was normalized to a housekeeping gene, GAPDH, to obtain the ΔCt values. The ΔΔCt values were then obtained by subtracting the ΔCt values for each gene of interest from the ΔCt values for the control sample. Results were calculated using the equation RQ=2^−ΔΔCt, where RQ is the relative quantity, and expressed as the fold change, relative to the gene expression levels in the control samples.

MTT (Sigma) and colony-forming assays were used to analyze cell proliferation. Cells were plated in 96-well plates at 3×10³ cells per well and cultured for 2, 4, 6, 8 and 10 days. The cell growth and viability were assessed following incubation in 0.1 mg/ml MTT at 37°C for 4 h. The cells were lysed in dimethylsulfoxide (Cellgro, Herndon, VA, USA) at room temperature for 10 min. Using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA), the absorbance in each well was measured at 492 nm. Colony-forming efficiency was determined by plating the cells at 10 cells/cm² in 60-mm dishes (Nunc A/S). After 14 days of culture, dishes were stained with Giemsa and the number of visible colonies was counted. Colony-forming efficiency was calculated as the percentage of the number of cells initially plated that gave rise to visible colonies (>45 cells).

ALP staining and analysis were performed after 14 days of incubation in differentiated culture medium. Cells were induced for osteoblast differentiation, washed twice in PBS, fixed in methanol/formalin (9:1; Ziyi, Shanghai, China) for 30 min and stained with the 5-bromo-4-chloro-3′-indolyphosphate p-toluidine salt/nitro-blue tetrazolium chloride Alkaline Phosphatase Color Development kit (C3206; Beyotime, Haimen, China) according to the manufacturer’s instructions. The ALP activity in the monolayers was determined using the p-Nitrophenyl Phosphate Liquid Substrate System (Sigma) according to the manufacturer’s instructions. Using a Multiskan Ascent microplate reader (Thermo Fisher Scientific, Inc.), the absorbance was measured at 405 nm.

Following being fixed in 4% paraformaldehyde (m/v) (Jianglaibio, Shanghai, China) for 10 min, hBMSCs were evaluated by ARS (ScienCell, San Diego, CA, USA) staining. Briefly, the cells were stained with 2% ARS (pH 4.1) for 15 min and washed twice in PBS. Orange and red staining indicated calcium nodules.

Statistical analysis of data was performed using the independent t-test and results were expressed as the mean ± SD. P<0.05 was considered to indicate a statistically significant difference. All statistical calculations were performed using SPSS software, version 17.0 (SPSS, Inc., Chicago, IL, USA).

The hBMSCs were isolated from the iliac crest of elderly patients with osteoporosis (n=4) and controls (n=5). The clinical characteristics of each donor are summarized in Table I. Before comparing the expression levels of miR-125b, the proliferation and osteogenic differentiation activity of hBMSCs that were derived from osteoporotic patients and control cases were estimated. The MTT assay was performed on hBMSCs of passage three to estimate the cell proliferation rate. Compared with hBMSCs derived from the control subjects, the hBMSCs derived from osteoporotic patients showed a slower growth rate with a low cell density (P<0.05; Fig. 1A). This result suggested a decreased proliferation rate of osteoporotic hBMSCs.

Upon osteogenic induction, hBMSCs were able to undergo osteogenic differentiation into osteoblasts. The osteogenic differentiation ability of hBMSCs was evaluated by ALP staining. Compared with the control hBMSCs, the senile osteoporotic hBMSCs showed decreased ALP activity (P<0.05; Fig. 1B), which indicated suppression of osteogenic differentiation of osteoporotic hBMSCs.

qPCR was used to estimate the expression levels of miR-125b in osteoporotic hBMSCs as well as the cells derived from the control subjects. Compared to the control hBMSCs, miR-125b expression levels in osteoporotic hBMSCs were significantly upregulated (P<0.05; Fig. 1C).

In conclusion, it was identified that the osteoporotic hBMSCs exhibited decreased cell proliferation and osteogenic differentiation, which correlated with increased expression levels of miR-125b. These results suggested that miR-125b may have a negative impact on cell proliferation or differentiation of hBMSCs; however, this requires validation and further investigation.

To study the impact of miR-125b expression on cell proliferation of hBMSCs, a miR-125b mimic and an miR-125b inhibitor were respectively transfected into normal individual hBMSCs. The miR-125b mimic, miR-125b inhibitor and non-specific negative control were designed and synthesized according to the protocol by Liu et al (9). The proliferative rate of hBMSCs was evaluated by MTT and colony-forming assays. Compared with the non-transfected (control) group, hBMSCs transfected with miR-125b inhibitor showed a slightly higher proliferation rate (Fig. 2A). However, the proliferative rate of hBMSCs was markedly suppressed in the presence of the miR-125b mimic. Furthermore, the colony-forming assay also showed consistent results. The colony-forming ability of hBMSCs was obviously decreased in the presence of the miR-125b mimic (P<0.05; Fig. 2B), while the inhibition of miR-125b in hBMSCs resulted in a slight increase in the number of colonies formed (P>0.05). These results suggested that the overexpression of miR-125b in normal hBMSCs was able to efficiently suppress the proliferative ability of hBMSCs.

To study the role of miR-125b expression on osteogenic differentiation in hBMSCs, the miR-125b mimic or the miR-125b inhibitor were transfected into hBMSCs and cultured in osteogenic differentiation medium. After 14 days of culture, the expression of various bone-related genes in hBMSCs was determined by qPCR. The expression of Runx-2, ALP, COL1α1 and OC were suppressed in hBMSCs transfected with the miR-125b mimic (Fig. 3A). By contrast, in the presence of miR-125b inhibitors, a significant increase in the expression levels of Runx-2, ALP, OC and COL1α1 was observed in hBMSCs (P<0.05) (Fig. 3A).

To further confirm these findings, transfected hBMSCs from each group were subjected to ALP staining on day 14 after culturing in conditioned media. The hBMSCs transfected with the miR-125b mimic showed poor ALP staining, while the hBMSCs transfected with miR-125b inhibitor stained strongly positive for ALP. This was a clear indication of the negative effects of miR-125b expression on osteogenic differentiation of hBMSCs (Fig. 3B and C). The degree of matrix mineralization of hBMSCs was further evaluated by Alizarin red staining on day 21 after transfection (Fig. 3B). Consistent with the results of ALP staining, Alizarin red staining revealed that inhibition of the function of miR-125b in hBMSCs obviously increased matrix mineralization activity (Fig. 3C). In conclusion, the results suggested that miR-125b has a negative regulatory role in osteogenic differentiation processes and the subsequent mineralization of hBMSCs.

The possible targets of miR-125b were predicted by online software including (accession date: April 2012): TargetScan (http://www.targetscan.org/) and PicTar (http://pictar.mdc-berlin.de/). Osx, one of the essential transcription factors for the regulation of osteogenic differentiation, was identified as a potential target of miR-125b.

To assess whether Osx was functionally associated with miR-125b, the expression levels of Osx in osteoporotic hBMSCs were assessed. Compared with the cells derived from normal adults, osteoporotic hBMSCs exhibited concurrently lower expression levels of Osx and higher expression levels of miR-125b (Fig. 4A). Furthermore, when the miR-125b mimic was overexpressed in hBMSCs, the expression levels of Osx were dramatically decreased. Furthermore, significantly increased Osx expression levels were observed in hBMSCs transfected with the miR-125b inhibitor (Fig. 4B). The results strongly suggested that Osx may be a target of miR-125b and may mediate the osteogenic differentiation regulated by miR-125b in hBMSCs.