The present study investigated the potential anticancer activity of the bark of Mangifera zeylanica, an endemic plant in Sri Lanka that has been traditionally used for cancer therapy. Cytotoxic and apoptotic effects were investigated
Breast cancer accounts for almost 1/4 of all cancers diagnosed in women (
Approval was obtained from the Department of Wildlife Conservation, Government of Sri Lanka (Columbo, Sri Lanka) for collecting M. zeylanica bark for research. The bark (2.5 kg) was collected from Imaduwa (Galle, Sri Lanka) and the plant was identified by a botanist at Bandaranayke Memorial Ayurvedic Research Institute (BMARI; Nawinna, Maharagama, Sri Lanka). The voucher specimen (#1221 A) was deposited at BMARI. All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified. Cell lines and 10% fetal bovine serum were acquired from the American Type Culture Collection (ATCC; Manassas, VA, USA).
Finely powdered dried bark (2.5 kg) was subjected to sequential extraction using hexane, chloroform, ethyl acetate and methanol (thrice with each solvent) by sonicating for 3 h at room temperature. All resulting extracts were filtered and evaporated using an R-3 rotary evaporator (BÜCHI Labortechnik AG, Flawil, Switzerland) under reduced pressure at 40°C to obtain crude extracts of hexane, chloroform, ethyl acetate and methanol. Stock solutions were prepared by dissolving in dimethyl sulfoxide (DMSO), and diluted to working solutions prior to use (the final DMSO concentration was 0.5% v/v).
Hexane extract of M. zeylanica was tested for the presence of polyphenols (
Free radical scavenging activity of the extract was investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay (
MCF-7 human ER-positive breast cancer cells, MDA-MB-231 triple-negative breast cancer cells, SKOV-3 ovarian epithelial cancer cells and MCF-10A normal mammary epithelial cells were maintained in ATCC-recommended medium [MCF-7 cells, Dulbecco's modified Eagle's medium (DMEM; ATCC 30–2002); MDA-MB-231 cells: Leibovitz's L-15 medium (ATCC 30–2008); SKOV-3 cells, McCoy's 5A medium (ATCC 30–2007); and MCF-10A cells, DMEM (ATCC 30–2002)] with 10% fetal bovine serum, insulin (Sigma-Aldrich; 0.01 mg/ml), streptomycin (Sigma-Aldrich; 0.1 mg/ml) and penicillin (Sigma-Aldrich; 100 U/ml). All cells were cultured at 37°C in an atmosphere of 5% CO2, with the exception of MDA-MB-231 cells, which were cultured without CO2. Cells were harvested by trypsinization and seeded into 96-well plates (product no. 3860-096; Iwaki Cell Biology, Iwaki, Japan) at a density of 5×103 cells/well. Following 24 h incubation, cells were treated with various doses (25, 50, 100, 200 or 400 µg/ml) of hexane, chloroform, ethyl acetate or methanol extracts, or mangiferin. The cytotoxic effect of the extracts was assessed by sulforhodamine B (SRB) assay following 24 h incubation (
The crude hexane extract, which was cytotoxic to cancer cells and less cytotoxic to normal cells, was subjected to a series of solvent-solvent partitions. It was initially partitioned between hexane and MeOH/H2O (9:1, v/v) and subsequently, following separation of the hexane layer, the aqueous layer was diluted with water to a composition of MeOH/H2O (6:4, v/v) and extracted with chloroform. The aqueous layer was subsequently concentrated under reduced pressure and partitioned between ethyl acetate and water. A total of four fractions, namely hexane-, chloroform-, ethyl acetate- and water-soluble fractions, were thus obtained. Cytotoxicity was contained in the chloroform-soluble fraction. The dried chloroform layer (1.1 g) was subjected to silica gel column chromatography (230–400 mesh; cat no. 177/03; Daihan Labtech India Pvt. Ltd., Delhi, India) and eluted with 100 ml each of hexane-ethyl acetate (8:2, 7:3, 6:4, 1:1, 4:6, 3:7, 2:8, 1:9, v/v), ethyl acetate-methanol (1:1, v/v) and methanol. All the solvents for chromatography separations were purchased from Sigma-Aldrich. Active fractions identified by SRB assay were monitored by normal-phase thin-layer chromatography (TLC) using hexane-ethyl acetate (1:1, v/v) as the mobile phase. As all cytotoxic fractions produced almost a clear spot during normal-phase TLC, all fractions were pooled and concentrated to give T1. T1 was monitored on reversed-phase TLC using methanol-water (9.5:0.5, v/v) as the mobile phase, fractionated in a reversed-phase column (C18), and eluted with 10 ml each of methanol-water (7:3, 8:3, 9:3, v/v) and methanol. Fractions identified as most cytotoxic by SRB assay were monitored by reversed-phase TLC using methanol-water (9:1, v/v) as the mobile phase. Following observation of the behaviour of these fractions in reversed phase-TLC, 500 µl from each active fraction was pooled to give the final fraction (M1) and its cytotoxicity to cancer cells and normal mammary epithelial cells was assessed.
The potential apoptotic effects of the hexane extract were assessed by investigating its effect on caspase-3 and −7 activity, morphological changes and DNA fragmentation. The effect on caspase-3 and −7 activity was determined in the three cancer cell lines. Cells were treated with the hexane extract for 4 h (25, 50, 100, 150 and 200 µg/ml) or 24 h (5, 10, 25, 50 and 100 µg/ml). Caspase activity was assessed using ApoTox-Glo™ triplex assay according to the manufacturer's protocol (Promega Corporation, Madison, WI, USA) and compared with untreated controls.
The three cancer cell lines (5×105 cells/ml) were treated with 200 and 400 µg/ml of the hexane extract for 24 h and harvested by trypsinization and centrifugation. The resulting cell pellets were subsequently incubated for 1 h at 55°C in freshly prepared lysis buffer (5 mM Tris-HCl, pH 8; 1 M NaCl and 5 mM ethylenediaminetetraacetic acid, pH 8; 0.5% sodium dodecyl sulfate and proteinase K; 200 µg/ml). Following incubation with RNaseA (200 µg/ml) for 2 h at 50°C, DNA was extracted using phenol-chloroform-isoamyl alcohol. Extracted DNA was visualised under ultraviolet light to assess the effect on DNA fragmentation (Quantum-ST4 1100/20 M; Fisher Biotec Pty Ltd., Wembley, Australia) following electrophoresis on a 2.0% agarose gel stained with ethidium bromide (EB).
Cell morphology was assessed by examining acridine orange (AO)/EB-stained (
The three cancer cell lines (200,000 cells/ml) were cultured in cell culture flasks, treated with the hexane extract at 100 or 150 µg/ml for 4 h, and 50 or 75 µg/ml for 24 h. Following treatment, cells were harvested and total RNA was extracted with TRIzol® Reagent (Invitrogen; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) according to the manufacturer's protocol. Total extracted RNA (2 µg) and 50 ng of random primers (Integrated DNA Technologies, Coralville, USA) were mixed in a PCR tube (0.2 ml) and the total volume was made up to 13.5 µl with diethylpyrocarbonate (DEPC)-treated ultrapure water for reverse transcription. The resulting RNA-random primer mixture was denatured at 70°C for 5 min and subsequently quenched on ice for 2 min to prevent formation of secondary structures. Complementary (c)DNA was synthesized by adding 5 µl 5X buffer, 5 µl 10 mM deoxynucleotide mixture (deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine triphosphate), 25 units of RNasin and 200 units of Moloney murine leukemia virus reverse transcriptase (all Thermo Fisher Scientific, Inc.), and the reaction mixture (25 µl) was incubated at 37°C for 60 min by using a thermal cycler. RT-qPCR was performed in Stratagene Mx3000P using the MESA Green qPCR Master Mix Plus for SYBR Assay (Eurogentec, Seraing, Liège, Belgium) with the primers listed in
Agilent GC-MS (7890A GC, 5975C MS; Agilent Technologies, Inc., Santa Clara, CA, USA) was used for chromatographic analysis. An ionization voltage of 70 eV, injector and detector temperatures of 260°C and 320°C, respectively, and J&W DB-5 MS capillary columns (30 m length, 250 µm internal diameter and 0.25 µm thickness) were used. The oven temperature was initiated at 110°C (isothermal for 5 min), increased to 280°C at 20°C/min (isothermal for 1 min) and increased again to 320°C at 20°C/min (isothermal for 5 min). Helium was the carrier gas and this was used at a flow rate of 1.5 ml/min, with an injector volume of 1 µl with splitless mode. The hexane extract and M1 fraction were dissolved in hexane (1 mg/ml), filtered through 0.2 µm syringe filters (Sigma-Aldrich) and injected into the GC-MS. The mass spectrum of each compound was identified by comparison to the National Institute of Standards and Technology library (
GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA) was used for statistical analysis. Results are expressed as the mean ± standard deviation of three independent experiments. One way analysis of variance with Dunnett's post hoc test was used to compare groups, and P<0.05 was considered to indicate a statistically significant difference.
From 2.5 kg of powdered bark material, 5.20, 5.89, 13.42 and 138.92 g of hexane, chloroform, ethyl acetate and methanol extracts were obtained, corresponding to yields of 0.208, 0.236, 0.5368 and 5.568%, respectively. Qualitative phytochemical investigation revealed that the hexane extract contained steroids, flavonoids, phenolic compounds, tannins and reducing sugars, while saponins were not detected (
IC50 values of the four solvent extracts of M. zeylanica bark, fraction M1, mangiferin and paclitaxel are provided in
In response to treatment with the hexane extract, caspase-3 and −7 activity significantly increased in MDA-MB-231 and SKOV-3 cells in a time- and dose-dependent manner (P<0.001) compared with the positive control (ascorbic acid; EC50=4.2 µg/ml); however, caspase-7 was not activated in MCF-7 cells at 4 or 24 h post-incubation (
The relative mRNA expression of the genes investigated in the three cancer cell lines is shown in
The DPPH free radical scavenging assay of the hexane extract gave an EC50 value of 33.1 µg/ml.
GC-MS analysis of the hexane extract of M. zeylanica bark tentatively identified 11 lipophilic compounds. The hexane extract was rich in sterols and long-chain hydrocarbons. Compositional analysis of the M1 fraction by GC-MS revealed that it contained 7 unknown compounds along with a small number of known compounds (
Of the four organic extracts of
The cytotoxicity of the hexane extract to ER-positive (MCF-7) and triple-negative breast cancer cells (MDA-MB-231), and to ovarian epithelial cells (SKOV-3) was dose-dependent, and this extract demonstrated reduced cytotoxicity to normal mammary epithelial cells. By contrast, the chloroform extract demonstrated reduced cytotoxicity in the cancer cells and increased cytotoxicity in the normal cells investigated in the present study. The M1 fraction, obtained from fractionation of the hexane extract, additionally demonstrated high levels of cytotoxicity in the three cancer cell lines and reduced cytotoxicity in normal mammary epithelial cells. Notably, the highest cytotoxicity was exerted on triple-negative cells. Mangiferin was not observed to exert cytotoxic effects on any of the cancer cell lines investigated in the present study. García-Rivera
The processes of homeostasis of organs and tissues depends upon the vital role of apoptosis, the dysregulation of which may be observed in cancer (
In the present study, characteristic features of apoptosis, including activation of caspase-3 and −7 (except in MCF-7 cells), nuclear fragmentation and chromatin condensation were clearly observed in the three cancer cell lines in response to treatment with the hexane extract of
Bax and p53 genes have significant roles in apoptosis; increased expression of Bax is known to induce apoptosis (
Oxidants are able to damage DNA and cause mutations, which may lead to carcinogenesis, and are additionally able to stimulate cell division (
GC-MS analysis of the hexane extract identified that it was rich in sterols and long-chain hydrocarbons. β-sitosterol and β-amyrin detected in the hexane extract have been reported to be cytotoxic and apoptosis-inducing compounds in MCF-7 breast cancer cells and HL-60 leukemia cells, respectively (
In conclusion, the results of the present study provide confirmatory evidence for the presence of anticancer compounds in
The present study was supported by the National Research Council (Colombo, Sri Lanka; grant no. NRC 11-018).
(A) Cytotoxic activity of the solvent extracts of
Caspase activation in cancer cell lines in response to the hexane extract of
Effect of the hexane extract of
Effect of the hexane extract of
Primers used for reverse transcription-quantitative PCR and the PCR product size.
Gene | Forward primer, 5′-3′ | Reverse primer, 5′-3′ | Size, bp |
---|---|---|---|
Bcl-2-associated X protein | TCCAGGATCGAGCAGGGCGAA | CGATGCGCTTGAGACACTCGCT | 109 |
Tumor protein p53 | TCTGGCCCCTCCTCAGCATCTT | TTGGGCAGTGCTCGCTTAGTGC | 369 |
Survivin | TGGCCGCTCCTCCCTCAGAAAA | GCTGCTGCCTCCAAAGAAAGCG | 190 |
GAPDH | GGCATTGCCCTCAACGACCAC | ACATGACAAGGTGCGGCTCCCTA | 283 |
PCR, polymerase chain reaction; Bcl, B-cell lymphoma 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Qualitative phytochemical screening of the hexane extract of
Phytochemical | Presence/absence |
---|---|
Steroids | ++++ |
Flavonoids | + |
Phenolic compounds | ++++ |
Tannins | + |
Reducing sugars | + |
Saponins | − |
++++, appreciable amount; +, low amount; -, not detectable.
IC50 values of solvent extracts of
IC50 value |
||||
---|---|---|---|---|
Extract/compound | MCF-7 cells |
MDA-MB-231 cells |
SKOV-3 cells |
MCF-10A cells |
Hexane extract, µg/ml | 87.64±0.37 | 116.5±0.32 | 86.6±0.48 | 217.2±0.33 |
Chloroform extract, µg/ml | 422.9±0.40 | 280.1±3.44 | 506.5±1.17 | 92.86±0.53 |
Ethyl acetate extract, µg/ml | >1000 | >1000 | >1000 | >1000 |
Methanol extract, µg/ml | >1000 | >1000 | >1000 | >1000 |
Mangiferin, µg/ml | >1000 | >1000 | >1000 | Not assessed |
Paclitaxel, µM | 0.9959±0.04 | 1.129±0.08 | 0.7807±0.03 | Not assessed |
M1 fraction, µg/ml | 28.05±0.84 | 15.42±0.41 | 38.66±0.42 | 114.6±0.32 |
Mean ± standard deviation of three independent experiments;
cancer cells;
normal cells. IC50, half maximal inhibitory concentration.
Major lipophilic compounds of the hexane extract and M1 fraction obtained from bioactivity-guided fractionation of the hexane extract of
A, Hexane extract | ||
---|---|---|
Retention time, min | Area, % | Compound name |
6.389 | 0.42 | 3-methyl heptadecane |
11.454 | 5.64 | Hexacosane |
13.650 | 0.42 | Campesterol |
13.816 | 0.47 | Stigmasterol |
14.222 | 2.90 | β-sitosterol |
14.224 | 2.90 | γ-sitosterol |
14.394 | 1.16 | Lanosterol |
14.892 | 6.76 | 9,19-cyclolanost-24-en-3-ol (cycloartenol) |
14.962 | 2.15 | Lanosterol |
15.026 | 1.21 | β-amyrin |
16.262 | 6.61 | 4,4-dimethyl-2-nonadecyl-5H-1,3-oxazole |
B, M1 fraction | ||
Retention time, min | Area, % | Compound name |
3.845 | 6.25 | Unknown |
4.315 | 1.36 | Unknown |
4.754 | 19.99 | Unknown |
5.883 | 3.49 | Oleana-2,12-dien-29-oic acid |
5.932 | 4.27 | Unknown |
6.942 | 1.27 | Unknown |
14.283 | 10.12 | Unknown |
22.754 | 1.48 | 2-ethylacridine |
31.593 | 1.25 | 2-oxo-n-propyl-2-(veratrylidenehydrazino) acetamide |