Contributed equally
Cancer stem cells (CSCs) are proposed to be closely correlated with the development and progression of tumors, as well as with chemo- and radioresistance. Targeting CSCs may therefore be a promising potential strategy for the treatment of cancer. Currently, natural products have received great interest due to their therapeutic efficacy and reduced adverse effects compared with modern chemotherapeutics. As a significant component of a number of traditional Chinese medicine formulas, the medicinal herb
Due to changes in diet structure and lifestyle, as well as the increase in the aging population, colorectal cancer (CRC) has become one of the most commonly observed malignancies worldwide, accounting for >1.2 million new cases and >600,000 mortalities each year (
Currently, natural products have received great interest due to their therapeutic efficacy and reduced adverse effects compared with modern chemotherapeutics (
Dulbecco's modified Eagle's medium (DMEM), DMEM/F12, fetal bovine serum (FBS), penicillin, streptomycin, 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA), 50X B27 supplement, Pierce radioimmunoprecipitation assay Buffer, Pierce bicinchoninic acid (BCA) Protein assay kit, SuperSignal™ West Pico Chemiluminescent Substrate and DreamTaq Green PCR Master mix (2X) were all purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) were obtained from PeproTech (Rocky Hill, NJ, USA). Hoechst 33342 and verapamil were purchased from Sigma Chemicals (St. Louis, MO, USA). Leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5; catalog. no. ab75732) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; catalog. no. ab181602) rabbit polyclonal antibodies were purchased from Abcam (Cambridge, UK). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (catalog. no. E030120-01) was purchased from Earthox (Millbrae, CA, USA). RNAiso Plus reagent and PrimeScript™ Reverse Transcription (RT) Reagent kit were purchased from Takara Bio, Inc. (Dalian, Liaoning, China). Water-soluble tetrazolium salts (WST)-1 assay kit and Blocking buffer were purchased for Beyotime Institute of Biotechnology (Shanghai, China).
EEHDW was prepared as previously described (
Human CRC HT-29 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cells were grown in DMEM containing 10% (v/v) FBS, 100 U/ml penicillin and 100 µg/ml streptomycin in a 37°C humidified incubator with an atmosphere of 5% CO2.
The SP assay is based on the efflux of Hoechst dye from cells via the ATP-binding cassette (ABC) family of transporter proteins expressed within the cell membrane. In the two-dimensional flow analysis chart, the cells are located on the side of a main cell population in a comet-like distribution; these cells are termed the ‘side population’. The verapamil control is an ABC transporter inhibitor. The SP from HT-29 cells was isolated and analyzed using MoFloTM XDP cell sorter flow cytometry (Beckman Coulter, Inc., Brea, CA, USA) as described previously (
Isolated HT-29 SP cells were seeded at a density of 2×105 cells/well into 6-well plates (NEST Biotechnology Co., Ltd., Wuxi, Jiangsu, China) in 2 ml DMEM culture medium. Following treatment with various concentrations of EEHDW (0, 0.5, 1 and 2 mg/ml) for 24 h at 37°C, cells were digested with 0.25% trypsin-EDTA and seeded at a density of 1.0×103 cells/well into Costar® 6-well Ultra-Low attachment plates (Corning, Inc., Corning, NY, USA), and cultured in DMEM/F12 serum-free stem cell culture medium. The medium was replaced every 2 days. Following 15 days of incubation, cells were collected and transferred into a new well in a 96-well plate (catalog. no. 205512; BD Diagnostics, Sparks Glencoe, MD, USA); and images were captured using a BD Pathway™ 855 at magnification, ×100 (BD Biosciences, Franklin Lakes, NJ, USA). A spheroid with >50 cells inside was considered to be a full sphere.
Cell viability was analyzed by WST-1 assay. Sorted SP cells were seeded at a density of 2.0×104 cells/well into 96-well plates, and incubated with serum-free stem cell culture medium for a total of 48 h at 37°C. Subsequently, cells were treated with various concentrations of EEHDW (0, 0.5, 1 and 2 mg/ml) for 24 h at 37°C. At the conclusion of the treatment period, 10 µl WST-1 were added to each well, and the samples were incubated for an additional 2 h at 37°C. The absorbance was measured at 450 nm using a microplate reader (ELx800 Absorbance Reader; BioTek Instruments, Inc., Winooski, VT, USA).
The sorted SP cells were seeded into 96-well plates at a density of 2.0×104 cells/well in 0.1 ml serum-free stem cell culture medium. The cells were treated with various concentrations of EEHDW (0, 0.5, 1 and 2 mg/ml) for 24 h at 37°C. Cell morphology was observed using a phase-contrast microscope (DMIL/DFC295; Leica Microsystems GmbH, Wetzlar, Germany). Images were captured at ×200 magnification.
HT-29 cells were seeded at a density of 2.5×105 cells/well into 6-well plates in 2 ml DMEM medium, and were treated with various concentrations of EEHDW (0, 0.5, 1 and 2 mg/ml) for a total of 24 h at 37°C. The treated cells were washed with PBS and scraped off into a tube, then lysed using lysis buffer containing protease and phosphatase inhibitor cocktails on ice for 15 min. Following high-speed centrifugation (12,000 × g) for 20 min at 4°C, supernatant containing the sample proteins was collected. The concentration of proteins was determined using the BCA Protein Assay Reagent kit. A total of 50 µg of protein was resolved using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and blotted onto nitrocellulose membranes. The membranes were blocked with blocking buffer and probed with primary antibodies against Lgr5 or GAPDH (1:1,000) overnight at 4°C, and subsequently with the appropriate HRP-conjugated goat anti-rabbit secondary antibody (1:5,000) for 1 h at room temperature. The chemiluminescence signals were visualized using the SuperSignal™ West Pico Chemiluminescent Substrate. Image Lab™ Software, version 3.0, was used for densitometric analysis/quantification of the western blotting (Bio-Rad Laboratories Inc., Hercules, CA, USA).
Total RNA from the HT-29 cells was isolated with RNAiso Plus reagent. Oligo (dT)-primed RNA (1 µg) was reverse transcribed using the PrimeScript RT Reagent kit according to the manufacturer's protocol. Briefly, the gDNA Eraser (1 µl) contained in the kit was used to remove the genomic DNA following incubation with the total RNA for 2 min at 42°C, then the PrimeScript RT Enzyme mix and RT Primer mix were added to perform RT using incubation for 15 min at 37°C. The obtained complementary DNA was used to determine the messenger (m)RNA quantity of c-Myc, β-catenin, PCNA, survivin and ABCB1 by PCR, using the DreamTaq Green PCR Master mix (2X). PCR was performed by the 3-step method, with a denaturation stage at 95°C for 30 sec, an annealing stage at an appropriate temperature (55°C for c-Myc, β-catenin and survivin, and 58°C for PCNA, ABCB1 and GAPDH) for 30 sec and an extension stage at 60°C for 30 sec for 30 cycles. GAPDH was used as an internal control. The primer were synthesized by Invitrogen, Thermo Fisher Scientific Inc., (Waltham, MA, USA) and the sequences used in the RT-PCR are listed in
Data were analyzed using SPSS for Windows (version 17.0; SPSS, Inc. Chicago, IL, USA). Statistical analysis of the data was performed with Student's t-test and analysis of variance. P<0.05 was considered to indicate a statistically significant difference.
The effect of EEHDW on cancer stem cells was determined by examining the SP proportion in HT-29 cells. As demonstrated in
In order to investigate EEHDW's effect on CSC growth, the present study evaluated the sphere formation of isolated HT-29 SP cells. As shown in
In order to elucidate the underlying mechanism of the anti-CSC activity of EEHDW, the present study examined the expression of ABCB1, β-catenin, c-Myc, PCNA and survivin in isolated HT-29 SP cells. As demonstrated in
Accumulating evidence has revealed the existence of cancer stem cells (CSCs) in the majority of leukemias and a number of solid tumors, including colorectal cancer (
Side population (SP) analysis is a commonly utilized technique for the identification and isolation of CSCs, and is based on the ability of CSCs to efflux Hoechst dye, due to the overexpression of ABC transporter proteins (
ABC transporter proteins are part of the superfamily of membrane pumps that remove certain xenobiotics from cells, including chemotherapeutic drugs and lipophilic fluorescent dyes, and contribute to the SP phenotype and chemotherapy resistance. ABC transporters are frequently overexpressed in CSCs (
The present study reported that HDW was able to markedly downregulate the expression of the CSC marker, Lgr5, and also significantly decrease the proportion of stem-like SP colorectal cancer HT-29 cells. In addition, HDW treatment significantly inhibited the viability and sphere formation, and induced morphological changes in the isolated HT-29 SP cells. Furthermore, HDW greatly suppressed the expression of several critical genes that mediate CSC features. The findings in this study suggest that HDW may exert inhibitory effects on CSCs.
The present study was sponsored by the Research Fund for the Doctoral Program of Higher Education of China (Beijing, China; grant no. 20133519110003) and the Developmental Fund of Chen Keji Integrative Medicine (Fujian, China; grant nos. CKJ2014013 and CKJ2015007).
colorectal cancer
cancer stem cells
side population
EEHDW inhibits the percentage of SP in human colorectal cancer HT-29 cells. (A) Following treatment with various concentrations of EEHDW (0, 0.5, 1 and 2 mg/ml) for 24 h, HT-29 cells were stained with Hoechst 33342 and percentages of SP were analyzed by FACS. Verapamil was used as a positive control. (B) Quantification of FACS analysis. Images are representative and data are expressed as the mean ± standard deviation of 3 independent experiments. *P<0.05 vs. untreated control cells. EEHDW, ethanol extract of
EEHDW inhibits the protein expression of Lgr5 in HT-29 cells. (A) The protein expression of Lgr5 in HT-29 cells was determined by western blot analysis. GAPDH was used as the internal control. (B) Densitometric analysis. The data were normalized to the mean protein expression of untreated control cells (100%). Images are representative and data are presented as the mean ± standard deviation of 3 independent experiments. *P<0.05 vs. untreated control cells. EEHDW, ethanol extract of
EEHDW inhibits the sphere formation capacity and viability of isolated HT-29 SP cells. (A) Following treatment with various concentrations (0, 0.5, 1 and 2 mg/ml) of EEHDW, SP cells were grown in serum-free stem cell culture medium for 15 days. Spheroids (>50 cells) were counted and photographed. (B) Quantification of sphere formation analysis. Images are representative and data are presented as the mean ± standard deviation of 3 independent experiments. *P<0.05 vs. untreated control cells. (C) SP cells were treated with the indicated concentrations (0, 0.5, 1 and 2 mg/ml) of EEHDW for 24 h. Cell viability was determined by the water-soluble tetrazolium salts-1 assay. Data are presented as the mean ± standard deviation. *P<0.05 vs. untreated control cells. EEHDW, ethanol extract of
EEHDW induces morphological changes in isolated HT-29 SP cells. Sorted SP cells were treated with the indicated concentrations (0, 0.5, 1 and 2 mg/ml) of EEHDW for 24 h and morphological changes were observed using phase-contrast microscopy. The images were captured at magnification, ×200. Images are representative of 3 independent experiments. EEHDW, ethanol extract of
EEHDW suppresses the mRNA expression of ABCB1, β-catenin, c-Myc, PCNA and survivin in isolated HT-29 SP cells. (A) Following treatment with the indicated concentrations (0, 0.5, 1 and 2 mg/ml) of EEHDW for 24 h, the mRNA expression of ABCB1, β-catenin, c-Myc, PCNA and survivin in sorted HT-29 SP cells was determined by reverse transcription-polymerase chain reaction. GAPDH was used as the internal control. (B) Densitometric analysis. The data were normalized to the mean mRNA expression of untreated controls (100%). Images are representative and data are presented as the mean ± standard deviation of 3 independent experiments. *P<0.05 vs. untreated control cells. EEHDW, ethanol extract of
Primer sequences for reverse transcription-polymerase chain reaction.
Gene | Primers, 5′→3′ |
---|---|
ABCB1 | |
Forward | TGACATTTATTCAAAGTTAAAAGCA |
Reverse | TAGACACTTTATGCAAACATTTCAA |
β-catenin | |
Forward | CCCACTGGCCTCTGATAATGG |
Reverse | ACGCAAAGGTGCATGATTTG |
c-Myc | |
Forward | CAGCTGCTTAGACGCTGGATT |
Reverse | GTAGAAATACGGCTGCACCGA |
PCNA | |
Forward | CCAAACCAGGAGAAAGT |
Reverse | GTGTCACCGTTGAAGAG |
Survivin | |
Forward | CAGATTTGAATCGCGGGACCC |
Reverse | CCAAGTCTGGCTCGTTCTCAG |
GAPDH | |
Forward | CGACCACTTTGTCAAGCTCA |
Reverse | AGGGGTCTACATGGCAACTG |
ABCB1, ATP-binding cassette, sub-family B, member 1; PCNA, proliferating cell nuclear antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.