OL Oncology Letters 1792-1074 1792-1082 D.A. Spandidos 10.3892/ol.2016.5116 OL-0-0-5116 Articles Chromosome 16q genes CDH1, CDH13 and ADAMTS18 are correlated and frequently methylated in human lymphoma AlkebsiLobna 1 HandaHiroshi 2 YokohamaAkihiko 3 SaitohTakayuki 4 TsukamotoNorifumi 4 MurakamiHirokazu 1 Department of Laboratory Sciences, Graduate School of Health Sciences, Gunma University, Gunma 371-8511, Japan Department of Medicine and Clinical Sciences, Graduate School of Medicine, Gunma University Hospital, Gunma 371-8511, Japan Blood Transfusion Service, Gunma University Hospital, Gunma 371-8511, Japan Oncology Center, Gunma University Hospital, Gunma 371-8511, Japan Correspondence to: Dr Lobna Alkebsi, Department of Laboratory Sciences, Graduate School of Health Sciences, Gunma University, 3-39-15 Showa-machi, Maebashi, Gunma 371-8511, Japan, E-mail: lobnakibsi@gmail.com 11 2016 09 09 2016 12 5 3523 3530 05062015 19082016 Copyright © 2016, Spandidos Publications 2016

The products of the E-cadherin (CDH1), H-cadherin (CDH13) and a disintegrin and metalloproteinase with thrombospondin motif 18 (ADAMTS18) genes are proteins displaying structural features and functions on the cell surface membrane, and have been reported to be involved in cancer progression. Using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and methylation-specific PCR (MSP) analysis, the promoter methylation status and messenger RNA (mRNA) expression levels of CDH1, CDH13 and ADAMTS18, which are putative tumor-suppressor genes located on chromosome 16q, were evaluated. In addition, the mRNA expression levels of DNA methyltransferases (DNMTs) 1, 3A and 3B were examined, and the correlations among the different parameters analyzed were studied in 36 lymphomas and 16 non-malignant lymphoid tissue samples. A significant positive correlation was identified between the expression levels of CDH1 and CDH13 (r=0.735, P<0.01). ADAMTS18 expression also exhibited a significant positive correlation with both CDH1 and CDH13 mRNA expression levels (r=0.625, P<0.01; and r=0.720, P<0.01, respectively). Our results indicated that CDH1, CDH13 and ADAMTS18, which are localized on chromosome 16q, are remarkably correlated and frequently methylated in human lymphomas, and their methylation could not be explained solely by the mRNA expression level of DNMTs.

 CDH1 CDH13 ADAMTS18 human lymphoma Introduction

Aberrant promoter hypermethylation contributes to the transcriptional inactivation of a number of genes in various malignant diseases (1). However, the precise mechanisms underlying this aberration remain unclear. DNA methylation is established by the catalytic activity of a family of DNA methytransferases (DNMTs), which includes DNMT1, DNMT3A and DNMT3B (2). The association between DNMTs expression and promoter hypermethylation of the tumor-suppressor gene (TSG) P15INA4B has been reported in acute myeloid leukemia (3). In another study on diffuse large B-cell lymphoma (DLBCL), the overexpression of DNMT3B and DNMT1 proteins was significantly correlated with the promoter hypermethylation of various genes, including p16 and von Hippel-Lindau (4). However, a lack of association between deregulated DNMTs expression and aberrant promoter methylation has also been reported (5–8).

E-cadherin, the gene product of CDH1, is a calcium-dependent cell adhesion molecule that is essential for maintaining the integrity of cell-cell adhesions (9). Downregulation of E-cadherin has been identified in numerous human cancers, and a loss of E-cadherin function was demonstrated to be associated with CDH1 promoter hypermethylation and increased invasiveness and metastasis in human tumors (9,10). However, in another study on DLBCL, CDH1 promoter hypermethylation was observed not to be correlated with the expression levels of DNMTs (4).

H-cadherin, the gene product of CDH13, is a novel member of the cadherin family (11). H-cadherin has a unique feature, in that it is devoid of a transmembrane domain, and is anchored to the cell surface membrane via a glycosylphosphatidylinositol (GPI) moiety instead. In addition, it also lacks a cytoplasmic domain (11). CDH13 downregulation has been associated with the tumorigenesis of multiple cancers (11). CDH13 silencing due to promoter hypermethylation and/or loss of heterozygosity is associated with tumor progression in BCLs (12).

A disintegrin and metalloproteinase with thrombospondin motif 18 (ADAMTS18) belongs to the ADAMTSs family, a group of secreted proteases that control several cell functions (13). Porter et al (14) demonstrated that there was a downregulation of several members of the ADAMTS family, including ADAMTS18, in human breast cancer compared with non-neoplastic mammary tissues. In addition, silencing of ADAMTS18 by methylation of promoter CpG islands has been reported in multiple carcinoma cell lines, particularly in cell lines derived from esophageal and nasopharyngeal carcinomas (15).

Tumor cells are characterized by frequent deletions of chromosomal regions that encode multiple TSGs (16). CDH1, CDH13 and ADAMTS18 are all located on chromosome 16q (16q22.1, 16q24.2 and 16q23.1, respectively). Similar to epigenetic modifications, genetic changes that are caused mainly by chromosomal loss of heterozygosity or mutations within the genes have been demonstrated to be associated with the upregulation of oncogenes or the downregulation of TSGs (16,17).

To the best of our knowledge, the correlations among the expression levels of CDH1, CDH13, ADAMTS18 and DNMTs, as well as their associations with the promoter methylation status of CDH1, CDH1 and ADAMTS18 in human lymphoma, have not been analyzed to date. Therefore, in the present study, the expression levels of CDH1, CDH13 and ADAMTS18 were investigated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) in human lymphoma. In addition, the frequency of methylation of the CDH1, CDH13 and ADAMTS18 gene promoters was examined using methylation-specific PCR (MSP). It was observed that these chromosome 16-located TSGs are frequently methylated and correlated, but they are not associated with the DNMTs levels in human BCL.

 Patients and methods <sec> <title>Patients

From the files of the Department of Hematology of Gunma University Hospital (Gunma, Japan), cases of surgically biopsied lymph nodes from patients that were collected between December 2006 and July 2012 were obtained upon receiving appropriate institutional review board approval from Gunma University and patients' written informed consent. For all cases, the diagnosis was based on a morphological and immunohistochemical analysis according to the World Health Organization classification (18). The criterion for the selection of these cases was the availability of fresh-frozen optimal cutting temperature compound-embedded tumor biopsy specimens collected prior to any treatment. The present study included 29 cases of DLBCL, 7 cases of mantle cell lymphoma and 16 samples of non-malignant lymphoid tissues (including necrotizing lymphadenitis, reactive lymph nodes, immunoglobulin G4-associated diseases, follicular hyperplasia and granulomatous lymphadenitis).

 Purification of genomic DNA (gDNA) and total RNA

gDNA and total RNA were purified from each tumor tissue using the AllPrep DNA/RNA Mini kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol.

 RT-qPCR

Total RNA (≤1 µg) for qPCR assays was treated and reverse transcribed using PrimeScript RT Reagent kit with gDNA Eraser (Takara Biotechnology Co., Ltd., Dalian, China) according to the protocol provided by the manufacturer. RT-qPCR was performed using SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) on a 7300 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Complementary DNA (1 µl) was mixed with gene-specific primers (listed in Table I), along with SYBR Green PCR Master Mix in a final volume of 20 µl. PCR was performed under the following conditions: Initial denaturation at 95°C for 10 min, followed by 45 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min. The relative level of expression of DNMTs, CDH1, CDH13 and ADAMTS18 were normalized using a reference gene (β-actin) and control cells (HL60), and calculations were performed using the 2−∆∆Cq method (19).

 Bisulfite modification and MSP

The extracted DNA was modified using the Methyl Easy Xceed Rapid DNA Bisulphite Modification kit (Genetic Signatures, Darlinghurst, Australia) according to the manufacturer's protocol. MSP was performed in a total volume of 20 µl, containing 2 µl sodium bisulfite- modified template DNA, using EpiTaq HS for bisulfite-treated DNA (Takara Biotechnology Co., Ltd.). Each MSP reaction was performed with the following conditions: Denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 30 sec, 30 sec at the specific annealing temperature for CDH1 and CDH13 [53°C for methylated (M) and 57°C for unmethylated (U) DNA] and ADAMTS18 (57°C for M and U DNA) and extension at 72°C for 30 sec, followed by a final 4-min extension at 72°C.

The primer sequences were as follows: CDH1 (CDH1UM sense, 5′-GGTTTGATTTGATTGTATTT-3′ and CDH1UM antisense, 5′-AAATACATCCCTCACAAAT-3′; and CDH1M sense, 5′-GGTTCGATTCGATCGTATTC-3′ and CDH1M antisense, 5′-GAATACGTCCCTCGCAAAT-3′); CDH13 (CDH13UM sense, 5′-TTGTGGGGTTGTTTTTTGT-3′ and CDH13UM antisense, 5′-AACTTTTCATTCATACACACA-3′; and CDH13M sense, 5′-TCGCGGGGTTCGTTTTTCGC-3′ and CDH13M antisense, 5′-GACGTTTTCATTCATACACGCG-3′); and ADAMTS18 (ADAMTS18UM sense, 5′-AAATTGTAGTTTGGTAGGTTTGT-3′ and ADAMTS18UM antisense, 5′-CAACTCCAAATAAAAACCACCA-3′; and ADAMTS18M sense, 5′-TTGTATTCGGTAGGTTCGC-3′ and ADAMTS18M antisense, 5′-ACTCCAAATAAAAACCGCCG-3′). Primer sequences were described previously (15,20,21) and were purchased from Eurofins MWG Operon, Inc. (Huntsville, AL, USA). MSP products were visualized under ultraviolet illumination following electrophoresis in 2% agarose gels containing GelRed nucleic acid gel stain (Biotium, Fremont, CA, USA).

 5-Aza-2′-deoxycytidine (5-aza-dC) treatment

Established lymphoma cell lines [Raji (22) (Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan), CTB-1 (23) and SLVL (24) (Riken, Saitama, Japan)] and one patient primary DLBCL cell line were cultured in RPMI-1640 medium (Wako Pure Chemical Industries, Ltd., Osaka, Japan) at 37°C in an atmosphere of 5% CO2 and treated with the demethylating agent 5-aza-dC (Wako Pure Chemical Industries, Ltd.). Cells (5×104) were grown in the absence or presence of 5-aza-dC at a concentration of 3 µM. The demethylation treatment was performed three times to verify the results.

 Statistical analysis

Using the SPSS 20 software (IBM SPSS, Armonk, NY, USA), differences in the mean rank values between groups were analyzed with the Mann-Whitney U test. The significance of associations between parameters were analyzed by Spearman's correlation coefficient. P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Expression of DNMTs, CDH1, CDH13 and ADAMTS18

The relative mRNA expression levels of DNMT1, DNMT3A, DNMT3B, CDH1, CDH13 and ADAMTS18 were detected by RT-qPCR in 36 cases of lymphoma and in 16 samples of non-malignant lymphoid tissue. The mean rank expression levels of DNMTs (1, 3A and 3B) in the lymphomas were significantly higher (P=0.044, P=0.036 and P=0.013) than those in the non-malignant tissues by 45.4, 45.9 and 60.4%, respectively (Fig. 1A-C). The expression of CDH1 and ADAMTS18 were both significantly (P<0.01) reduced in lymphomas by 36.0% with respect to non-malignant tissues, while CDH13 expression was non-significantly reduced by 14.4% in lymphomas compared with non-malignant tissues (Fig. 1D-F).

 Methylation status of CDH1, CDH13 and ADAMTS18, and their association with the mRNA expression levels of DNMTs, CDH1, CDH13 and ADAMTS18

MSP was used (Fig. 2) to investigate the promoter methylation status of CDH1, CDH13 and ADAMT18 in 36 lymphoma and 16 non-malignant lymphoid tissue samples. Promoter hypermethylation of CDH1, CDH13 and ADAMTS18 was detected in 31/36 (86.1%), 33/36 (91.7%) and 28/36 (77.8%) lymphomas, respectively, and in 4/16 (25.0%), 8/16 (50.0%) and 5/16 (31.3%) non-malignant tissue samples, respectively. The expression of CDH1 and ADAMTS18 was significantly (P=0.008 and P=0.019, respectively) reduced in samples with a hypermethylated promoter compared with those with an unmethylated promoter, while CDH13 expression displayed a non-significant reduction (17.9%) in subjects with a methylated CDH13 promoter (Fig. 3A). No associations were identified between the increased levels of DNMTs mRNA and the CDH1, CDH13 or ADAMTS18 promoter hypermethylation (Fig. 3B-D).

To confirm that promoter methylation was responsible for the silencing of CDH1, CDH13 and ADAMTS18 expression, methylated lymphoma cell lines were treated with 5-aza-dC, a demethylating agent, and CDH1, CDH13 and ADAMTS18 expression was examined by RT-qPCR. Upon treatment with 5-aza-dC, the promoter region of the CDH1, CDH13 and ADAMTS18 genes exhibited hypomethylation, and their mRNA expression levels were increased (Fig. 4).

 Associations between the relative mRNA expression levels of CDH1, CDH13 and ADAMTS18

The correlations between the different tested parameters were evaluated across the spectrum of both lymphoma and non-malignant tissues. The CDH1 expression level exhibited a significantly positive correlation with the CDH13 expression level (r=0.735, P<0.01) (Fig. 5A). Furthermore, the ADAMTS18 expression level was positively correlated with the CDH1 and CDH13 expression levels (r=0.625, P<0.01; and r=0.720, P<0.01, respectively) (Figs. 5B and C).

 Discussion

Promoter hypermethylation and loss of function of CDH1, CDH13 and ADAMTS18 have been reported in various cancers and cancer cell lines (10,11,13). In the present study, the promoter methylation of CDH1, CDH13 and ADAMTS18, which are putative TSGs located on chromosome 16q (16q22.1, 16q24.2 and 16q23.1, respectively), was investigated using MSP, and the expression levels of DNMTs, CDH1, CDH13 and ADAMTS18 were examined using RT-qPCR to study whether these parameters are correlated and associated with DNMTs in human BCL.

Methylation of the CDH1 promoter CpG islands and consequent loss of E-cadherin expression has been reported in multiple tumor tissues (25–31). ADAMTS18 has been reported to be downregulated through promoter methylation in esophageal and nasopharyngeal cancer cell lines (15). In the present study, the relative mRNA expression levels of CDH1 and ADAMTS18 were both significantly reduced in lymphoma samples by 36.0% with respect to non-malignant tissues. In addition, promoter hypermethylation of CDH1 and ADAMTS18 was detected in 31/36 (86.1%) and 28/36 (77.8%) of lymphomas, respectively. Furthermore, the reduction of CDH1 and ADAMTS18 was significantly associated with their corresponding hypermethylated promoters when compared with their unmethylated promoters. Therefore, the current results suggest that the aberrant expression of CDH1 and ADAMTS18 and their promoter hypermethylation may be important in lymphomagenesis.

CDH13 downregulation due to promoter hypermethylation has been observed in various cancers (11), including BCLs (12). In the present study, the relative mRNA expression level of CDH13 in human lymphomas was reduced by 14.4% (not significant) compared with that in non-malignant tissues. Furthermore, methylation of CDH13 was detected more frequently in lymphoma (91.7%) than in non-malignant tissues (50.0%), and there was a non-significant reduction in CDH13 expression in subjects with a methylated CDH13 promoter (17.9%). No significant differences were observed among the expression levels of DNMTs in subjects with a methylated CDH13 promoter compared with those with unmethylated promoters. These non-significant results may be due to the fact that human clinical samples are heterogeneous, with cytological diversity and different variants that may neutralize the aberrant expression of genes.

Genes with transcriptional inactivation due to methylation are sensitive to DNA methylation inhibitors and can easily be reactivated (32). The methylation inhibitor 5-aza-dC, can be incorporated during DNA synthesis, and reduces the capacity for DNA methylation by DNMTs, thus reversing the methylation status of the promoters of genes (32,33). In the present study, methylated BCL cell lines (Raji, CTB-1, SLVL) and a primary patient cell line were treated with 5-aza-dC. Following demethylation treatment, the expression levels of CDH1, CDH13 and ADAMTS18 mRNA were upregulated ≥2-fold, with corresponding complete or partial promoter hypomethylation.

By contrast, in the current surgically-resected tumor samples, not apparent significant correlation was identified between the methylation status of TSGs and the expression levels of DNMTs. These findings are in agreement with previous studies that failed to demonstrate any significant correlation between DNMTs expression and aberrant promoter methylation of the tested genes (5,6,34,35). This finding can be explained by the fact that the overexpression of DNMTs is considered to be the primary mechanism responsible for the hypermethylation of TSGs in cancer cells, while a gain of methylation could also be secondary to the overexpression of transcriptional repressors or to the loss of transcriptional activators, as well as the result of an interallelic transfer of methylation via gene pairing (6,36). Another study (8) revealed that transgenic overexpression or complete depletion of DNMT3B did not affect the methylation status of HCT-116 colon cancer cells. Furthermore, in the present study, the expression levels of DNMTs mRNAs were significantly higher in lymphomas than in non-malignant tissue samples. This may be attributable to differences in the cell proliferation rate between lymphomas and non-malignant tissues (6). Taken together, since tumor cell lines are developed from single cells, and therefore consist of cells with a uniform genetic composition, it is logical that the expression of genes displayed a clearer association with their corresponding promoter's methylation status than with that observed in the heterogeneous tumor clinical samples.

CDH1 and CDH13 are important cell adhesion molecules, and alterations in their structure and function often cause a reduction in the adhesion between tumor cells, which may cause the detachment of cells from the primary tumors and the acquisition of invasive and metastatic properties (10,11). Notably, in the present study, a significant positive correlation between the expression levels of both CDH1 and CDH13 was observed. Regulation of VE-cadherin by N-cadherin was previously described in non-malignant human umbilical vein endothelial cells (37). It has also been demonstrated that N-cadherin and VE-cadherin are co-expressed in human breast cancer (38). N-cadherin controls the expression of VE-cadherin, and the latter regulates the subcellular localization of N-cadherin by causing its translocation from the cell surface (38). Since CDH13 lacks the transmembrane and cytoplasmic regions of other cadherins, and instead uses a GPI anchor and the interactions with specific ligands (11), we suggest that CDH1 may interact with CDH13 and facilitate its signaling inside the cell.

In addition, the present study identified significant positive correlations between the expression level of ADAMTS18 and the expression levels of CDH1 and CDH13. ADAMTSs, including ADAMTS18, are important in mediating the degradation of extracellular matrix proteins, as well as the ectodomain shedding of growth factors, growth factor receptors and adhesion molecules (13). Interactions between metalloproteinases and adhesion molecules have been reported (10,39,40). For example, Maretzky et al (39) demonstrated that ADAM10 contributes to E-cadherin shedding and to cell proliferation by modulating β-catenin signaling through E-cadherin shedding. Furthermore, ADAM15 catalyzes soluble E-cadherin shedding, which in turn leads to its binding to the ErbB receptor and to the stimulation of ErbB receptor signaling via human epidermal growth factor (HER) 2 and HER3 in breast cancer cells (40). Therefore, the positive correlations between ADAMTS18 and CDH1 and CDH13 mRNA in the current study may reflect the requirement of ADAMTS for cadherin processing in the cells, and also suggest the existence of a common factor regulating these genes, which are all located on chromosome 16q, thus further emphasizing the importance of this region.

Of note, as presented in Fig. 5B and C, the expression of ADAMTS18 in replicate samples (16/52 samples, 30.8%) did not display any correlation with the expression of either CDH1 or CDH13. The complete lack of ADAMTS18 expression and the absence of correlation with CDH1, CDH13 or DNMTs in these patients' samples may imply that there is a loss of the ADAMTS18 gene locus.

Furthermore, to support our hypothesis that chromosome 16 and cell surface membrane-located TSGs are correlated with each other in human BCL, the present study examined the expression of another TSG located on the same chromosome, cyclin-dependent kinase inhibitor (CDKN) 2A (p16). It was observed that the expression levels of our tested TSGs did not exhibit any correlation with the CDKN2A expression level (data not shown).

In conclusion, our findings demonstrated that the expression levels of TSGs adjacently located at chromosome 16q (CDH1, CDH13 and ADAMT18) are positively correlated and frequently methylated, and that their methylation status is not associated with the expression levels of DNMTs in human lymphoma. Our findings suggest that aberrantly methylated cell surface membrane TSGs located on chromosome 16q are correlated and may be important role in the pathogenesis of human BCL.

 Acknowledgements

The abstract was presented at the 55th American Society of Hematology (ASH) Annual Meeting and Exposition December 7–10, 2013 in New Orleans, LA and published as abstract no. 21 in Blood 122: 4289, 2013. The authors would like to thank Miss Rumiko Koitabashi (Department of Medicine and Clinical Sciences, Graduate School of Medicine, Gunma University, Gunma, Japan) for supporting the present study by collecting the patients' samples. The current study was supported in part by the National Cancer Research and Development Fund (Tokyo, Japan, grant no. 23-A-17).

 References Akhavan-NiakiHSamadaniAADNA methylation and cancer development: Molecular mechanismCell Biochem Biophys67501513201310.1007/s12013-013-9555-223508887 BestorTHThe DNA methyltransferases of mammalsHum Mol Genet923952402200010.1093/hmg/9.16.239511005794 MizunoSChijiwaTOkamuraTAkashiKFukumakiYNihoYSasakiHExpression of DNA methyltransferases DNMT1, 3A and 3B in normal hematopoiesis and in acute and chronic myelogenous leukemiaBlood9711721179200110.1182/blood.V97.5.117211222358 AmaraKZiadiSHachanaMSoltaniNKorbiSTrimecheMDNA methyltransferase DNMT3b protein overexpression as a prognostic factor in patients with diffuse large B-cell lymphomasCancer Sci10117221730201010.1111/j.1349-7006.2010.01569.x20398054 OueNKuraokaKKuniyasuHYokozakiHWakikawaAMatsusakiKYasuiWDNA methylation status of hMLH1, p16 (INK4a) and CDH1 is not associated with mRNA expression levels of DNA methyltransferase and DNA demethylase in gastric carcinomasOncol Rep810851089200111496321 SatoMHorioYSekidoYMinnaJDShimokataKHasegawaYThe expression of DNA methyltransferases and methyl-CpG-binding proteins is not associated with the methylation status of p14(ARF), p16(INK4a) and RASSF1A in human lung cancer cell linesOncogene2148224829200210.1038/sj.onc.120558112101420 ParkHJYuEShimYHDNA methyltransferase expression and DNA hypermethylation in human hepatocellular carcinomaCancer Lett233271278200610.1016/j.canlet.2005.03.01715885882 HagemannSKuckDStresemannCPrinzFBruecknerBMundCMumbergDSommerAAntiproliferative effects of DNA methyltransferase 3B depletion are not associated with DNA demethylationPloS One7e36125201210.1371/journal.pone.003612522563479 StrathdeeGEpigenetic versus genetic alterations in the inactivation of E-cadherinSemin Cancer Biol12373379200210.1016/S1044-579X(02)00057-312191636 RodriguezFJLewis-TuffinLJAnastasiadisPZE-cadherin's dark side: Possible role in tumor progressionBiochim Biophys Acta18262331201222440943 AndreevaAVKutuzovMACadherin 13 in cancerGenes Chromosomes Cancer49775790201020607704 OgamaYOuchidaMYoshinoTItoSTakimotoHShioteYIshimaruFHaradaMTanimotoMShimizuKPrevalent hyper-methylation of the CDH13 gene promoter in malignant B cell lymphomasInt J Oncol25685691200415289870 RocksNPaulissenGEl HourMQuesadaFCrahayCGuedersMFoidartJMNoelACataldoDEmerging roles of ADAM and ADAMTS metalloproteinases in cancerBiochimie90369379200810.1016/j.biochi.2007.08.00817920749 PorterSScottSDSassoonEMWilliamsMRJonesJLGirlingACBallRYEdwardsDRDysregulated expression of adamalysin-thrombospondin genes in human breast carcinomaClin Cancer Res1024292440200410.1158/1078-0432.CCR-0398-315073121 JinHWangXYingJWongAHLiHLeeKYSrivastavaGChanATYeoWMaBBEpigenetic identification of ADAMTS18 as a novel 16q23.1 tumor suppressor frequently silenced in esophageal, nasopharyngeal and multiple other carcinomasOncogene2674907498200710.1038/sj.onc.121055917546048 KnudsonAGTwo genetic hits (more or less) to cancerNat Rev Cancer1157162200110.1038/3510103111905807 JonesPABaylinSBThe fundamental role of epigenetic events in cancerNat Rev Genet3415428200212042769 SwerdlowSHCampoEHarriNLJaffeESPileriSAStainHThieleJVardimanJWWHO Classification of Tumours of Haematopoietic and Lymphoid Tissues24thIARC PressLyon2008 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) MethodMethods25402408200110.1006/meth.2001.126211846609 SakaiMHibiKKoshikawaKInoueSTakedaSKanekoTNakaoAFrequent promoter methylation and gene silencing of CDH13 in pancreatic cancerCancer Sci95588591200410.1111/j.1349-7006.2004.tb02491.x15245595 AsiafAAhmadSTAzizSAMalikAARasoolZMasoodAZargarMALoss of expression and aberrant methylation of the CDH1 (E-cadherin) gene in breast cancer patients from KashmirAsian Pac J Cancer Prev1563976403201410.7314/APJCP.2014.15.15.639725124632 KarpovaMBSchoumansJErnbergIHenterJINordenskjoldMFadeelBRaji revisited: Cytogenetics of the original Burkitt's lymphoma cell lineLeukemia19159161200515457187 UchidaYMiyazawaKYaguchiMGotohAIwaseOOhyashikiKToyamaKEstablishment of a novel B-lymphoma cell line, CTB-1, with strong Pas antigen expression having chromosomal translocation (14;22)Int J Oncol1011031107199721533490 InokuchiKAboJTakahashiHMiyakeKInokuchiSDanKNomuraTEstablishment and characterization of a villous lymphoma cell line from splenic B-cell lymphomaLeuk Res19817822199510.1016/0145-2126(95)00059-38551798 JeongDHYoumMYKimYNLeeKBSungMSYoonHKKimKTPromoter methylation of p16, DAPK, CDH1 and TIMP-3 genes in cervical cancer: Correlation with clinicopathologic characteristicsInt J Gynecol Cancer1612341240200610.1111/j.1525-1438.2006.00522.x16803511 HarbstKStaafJMåsbäckAOlssonHIngvarCVallon-ChristerssonJRingnérMBorgAJönssonGMultiple metastases from cutaneous malignant melanoma patients may display heterogeneous genomic and epigenomic patternsMelanoma Res20381391201020848731 KimDSKimMJLeeJYKimYZKimEJParkJYAberrant methylation of E-cadherin and H-cadherin genes in nonsmall cell lung cancer and its relation to clinicopathologic featuresCancer11027852792200710.1002/cncr.2311317960794 MatsumuraTMakinoRMitamuraKFrequent down-regulation of E-cadherin by genetic and epigenetic changes in the malignant progression of hepatocellular carcinomasClin Cancer Res7594599200111297254 BarberMMurrellAItoYMaiaATHylandSOliveiraCSaveVCarneiroFPatersonALGrehanNMechanisms and sequelae of E-cadherin silencing in hereditary diffuse gastric cancerJ Pathol216295306200810.1002/path.242618788075 LingZQLiPGeMHZhaoXHuFJFangXHDongZMMaoWMHypermethylation-modulated down-regulation of CDH1 expression contributes to the progression of esophageal cancerInt J Mol Med27625635201110.3892/ijmm.2011.64021373750 QianZRSanoTYoshimotoKAsaSLYamadaSMizusawaNKudoETumor-specific downregulation and methylation of the CDH13 (H-cadherin) and CDH1 (E-cadherin) genes correlate with aggressiveness of human pituitary adenomasMod Pathol2012691277200710.1038/modpathol.380096517873891 LingZQSugiharaHTatsutaTMukaishoKHattoriTOptimization of comparative expressed sequence hybridization for genome-wide expression profiling at chromosome levelCancer Genet Cytogenet175144153200710.1016/j.cancergencyto.2007.02.01117556071 MurgoAJInnovative approaches to the clinical development of DNA methylation inhibitors as epigenetic remodeling drugsSemin Oncol32458464200510.1053/j.seminoncol.2005.07.00416210086 EadsCADanenbergKDKawakamiKSaltzLBDanenbergPVLairdPWCpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpressionCancer Res5923022306199910344733 SaitoYKanaiYSakamotoMSaitoHIshiiHHirohashiSExpression of mRNA for DNA methyltransferases and methyl-CpG-binding proteins and DNA methylation status on CpG islands and pericentromeric satellite regions during human hepatocarcinogenesisHepatology33561568200110.1053/jhep.2001.2250711230735 TyckoBEpigenetic gene silencing in cancerJ Clin Invest105401407200010.1172/JCI946210683367 LuoYRadiceGLN-cadherin acts upstream of VE-cadherin in controlling vascular morphogenesisJ Cell Biol1692934200510.1083/jcb.20041112715809310 RezaeiMFriedrichKWielockxBKuzmanovAKettelhakeALabelleMSchnittlerHBarettonGBreierGInterplay between neural-cadherin and vascular endothelial-cadherin in breast cancer progressionBreast Cancer Res14R154201210.1186/bcr336723216791 MaretzkyTReissKLudwigABuchholzJScholzFProkschEde StrooperBHartmannDSaftigPADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocationProc Natl Acad Sci USA10291829187200510.1073/pnas.050091810215958533 NajyAJDayKCDayMLThe ectodomain shedding of E-cadherin by ADAM15 supports ErbB receptor activationJ Biol Chem2831839318401200810.1074/jbc.M80132920018434311

Relative messenger RNA expression levels of DNMT1, DNMT3A, DNMT3B, CDH1, CDH13 and ADAMTS18. The expression levels were determined by reverse transcription-quantitative polymerase chain reaction in 36 cases of lymphoma (29 diffuse large B-cell lymphoma and 7 mantle cell lymphoma) and 16 samples of non-malignant lymphoid tissues. Relative (A) DNMT1, (B) DNMT3A, (C) DNMT3B, (D) CDH1, (E) CDH13 and (F) ADAMTS18 expression levels (*P<0.05, **P<0.01 by the Mann-Whitney U test). DNMT, DNA methyltransferase; CDH1, E-cadherin; CDH13, H-cadherin; ADAMTS18, a disintegrin and metalloproteinase with thrombospondin motifs 18; NS, not significant.

Methylation-specific PCR. The DNA methylation status of CDH1, CDH13 and ADAMTS18 was assessed for selected lymphoma and non-malignant samples that were amplified by PCR with primers specific for the U or M CpG islands of the target genes upon modification with sodium bisulfite. PCR, polymerase chain reaction; CDH1, E-cadherin; CDH13, H-cadherin; ADAMTS18, a disintegrin and metalloproteinase with thrombospondin motifs 18; M, methylated; U, unmethylated.

(A) Relative CDH1, CDH13 and ADAMTS18 mRNA expression levels and their corresponding promoter methylation status. (B-D) Correlations among the methylation status of (B) CDH1, (C) CDH13 and (D) ADAMTS18 and the mRNA expression levels of DNMT1, DNMT3A and DNMT3B (*P<0.05, **P<0.01 by the Mann-Whitney U test). DNMT, DNA methyltransferase; CDH1, E-cadherin; CDH13, H-cadherin; ADAMTS18, a disintegrin and metalloproteinase with thrombospondin motifs 18; NS, not significant; M, methylated; U, unmethylated; mRNA, messenger RNA.

Treatment of lymphoma cell lines with 5-aza-dC. (A) CDH1, (B) CDH13 and (C) ADAMTS18 messenger RNA expression levels and their corresponding promoter methylation status prior and subsequent to the treatment of lymphoma cell lines (Raji, CTB-1 and SLVL) and one primary cell line from a patient with diffuse large B-cell lymphoma with 5-aza-dC at a concentration of 3 µM for three times. CDH1, E-cadherin; CDH13, H-cadherin; ADAMTS18, a disintegrin and metalloproteinase with thrombospondin motifs 18; NS, not significant; M, methylated; U, unmethylated; pt, patient; 5-aza-dC, 5-aza-2′-deoxycytidine. Originally published in Blood 122: 4289, 2013.

Correlations across the spectrum of both lymphoma and non-malignant tissues (n=52). (A) Correlation of the relative expression levels of CDH1 and CDH13. (B and C) Correlation of the relative expression levels of ADAMTS18 with (B) CDH1 and (C) CDH13 (**P<0.01 by Spearman's correlation coefficient). CDH1, E-cadherin; CDH13, H-cadherin; ADAMTS18, a disintegrin and metalloproteinase with thrombospondin motifs 18. Originally published in Blood 122: 4289, 2013.

Primers, amplicon sizes and accession number of genes analyzed by RT-qPCR.

Target genes Primer sequences (5′-3′)a Size (bp) Accession number
DNMT1 GCCAACGAGTCTGGCTTTGAG (sense) 101 NM001130823
GTGTCGATGGGACACAGGTGA (antisense)
DNMT3A ACCCGACTTCATAATGGTGCTTTC (sense) 139 NM022552
CGCCATCTGCAAGCTGTCTC (antisense)
DNMT3B TAAATACAAGGGCTGGAGTCTGCAC (sense)   80 NM006892
TGACGTCATCCCTGCTGAAATC (antisense)
CDH1 GAGTGCCAACTGGACCATTCAGTA (sense)   86 NM0043603
AGTCACCCACCTCTAAGGCCATC (antisense)
CDH13 GACATTGTCACTGTTGTGTCACCTG (sense) 121 NM0012573
CCGTGCCTGTTAATCCAACATC (antisense)
ADAMTS18 AAGTGACATAAACGTGGTTGTGGTG (sense)   89 NM1993552
GAGACTGGTCTGCATGATGGTTG (antisense)
β-actin TGGCACCCAGCACAATGAA (sense) 186 NM_0011013
CTAAGTCATAGTCCGCCTAGAAGCA (antisense)

Primers were purchased from Takara Biotechnology Co., Ltd. and designed using One Step PrimeScript™ RT-PCR kit (Perfect Real Time), which is an online support system to search for optimized primers when using SYBR® Green I detection in RT-qPCR. DNMT, DNA methyltransferase; CDH1, E-cadherin; CDH13, H-cadherin; ADAMTS18, a disintegrin and metalloproteinase with thrombospondin motifs 18; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.