Evidence is rapidly accumulating that long non-coding RNAs (lncRNAs) are involved in human tumorigenesis and are dysregulated in multiple cancers, including hepatocellular carcinoma (HCC). lncRNAs can regulate essential pathways that contribute to tumor initiation and progression with tissue specificity, which suggests that lncRNAs may be valuable biomarkers and therapeutic targets. HOX transcript antisense intergenic RNA (HOTAIR) has previously been demonstrated to be an oncogene and a negative prognostic factor in a variety of cancers; however, the factors that contribute to the upregulation of HOTAIR and the interaction between HOTAIR and microRNAs (miRNAs or miRs) are largely unknown. In the present study, the expression levels of HOTAIR, forkhead box C1 (FOXC1) and miRNA-1 were examined in 50 matched pairs of HCC and HCC cells. The effects of HOTAIR on HCC cell proliferation were tested using trypan blue exclusion assay. The effect of HOTAIR on HCC growth
Hepatocellular carcinoma (HCC) is the third leading cause of cancer-associated mortalities, with nearly 600,000 mortalities occurring worldwide each year (
Non-coding RNAs (ncRNAs) are subdivided into two groups: Small ncRNAs (<200 nt) and long ncRNAs (lncRNAs) (
The mechanism by which HOTAIR exerts its oncogenic activity remains largely unknown. A regulatory mechanism has been proposed in which RNAs cross-talk via competing shared miRs (
Fresh-frozen and paraffin-embedded HCC tissues and corresponding adjacent non-tumorous gastric samples were obtained from Chinese patients at Shenzhen People's Hospital (Shenzhen, China) between January 2010 and December 2014. All cases were reviewed by a pathologist and histologically confirmed as HCC. Informed consent was obtained from all patients and the study was approved by the Institutional Ethics Committee of Shenzhen People's Hospital.
The sequence of HOTAIR was obtained (
The mature hsa-miR-1 sequence (5′-UGGAAUGUAAAGAAGUAUGUAU-3′) is available from the miR registry (MIMAT000416;
HCC HepG2 and LO2 cells were purchased from the Shanghai Institute of Cell Biology (Shanghai, China). The cell lines were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences, Logan, UT, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.). Cells were maintained in a humidified incubator at 37°C in the presence of 5% CO2. All cell lines were passaged for <6 months.
All plasmid vectors (pmiR-1, pFOXC1 and empty vector) used for cell transfection were extracted using Hieff Trans™ Liposomal Transfection Reagent (Yeasen Biotechnology Co., Ltd., Shanghai, China). HepG2 cells cultured on 6-well plates were transfected with pmiR-1, pFOXC1 or empty vector using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Cells were harvested after 48 h for quantitative polymerase chain reaction (qPCR). Methods for transfecting cells with LV3-HOTAIR were adopted, as previously described (
The density of the HepG2 cell line suspension was determined by counting on a hemacytometer. A 0.4% solution of trypan blue in phosphate-buffered saline (PBS) was prepared (pH 7.2–7.3). Trypan blue stock solution (0.1 ml) was added to 1 ml of cells. A hemacytometer was loaded and examined immediately under a microscope at low magnification. The number of blue-stained cells and the number of total cells were counted. Cell viability was considered to be ≥95% for healthy log-phase cultures. The percentage of viable cells was calculated as follows: Viable cells (%) = [1.00 − (number of blue-stained cells/number of total cells)] × 100.
A total of 15 BALB/c (nu/nu) male mice (200±2.6 g; age, 3 months) from the Animal Center of Guangzhou Province (Guangdong, China) received subcutaneous injections of 2×106 HepG2 cells into the axillae bilaterally. The mice were housed in a pathogen-free environment at a temperature of 20–26°C and were exposed to 12 h light/dark cycles with free access to food and water. When xenograft tumors became palpable (~0.1 mm3), mice were randomly divided (n=5 mice/group) into a control group receiving a PBS injection (100 µl), a transfection group receiving LV3-HOTAIR (200 nM) and a NC group receiving LV3 + scramble sequence (200 nM). There was no difference in the baseline tumor size between the groups. Tumor volume was calculated every 3 days according to the following formula: V=ab2π/6, where ‘a’ is the maximum tumor diameter and ‘b’ is the minimum tumor diameter. After treatment for 20 days, the mice were euthanized, and the tumors were extirpated and weighed.
HepG2 cells were treated with formaldehyde and incubated for 10 min to generate DNA-protein cross-links. Cell lysates were then sonicated to generate chromatin fragments of 200–300 bp and immunoprecipitated with anti-FOXC1 (cat. no. 625905; 1:1,000; R&D Systems China Co., Ltd., Shanghai, China) for 1 h at room temperature or Alexa Fluor® 488 conjugated-immunoglobulin G (IgG) antibody (cat. no. 4408; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA) for 30 min at room temperature as a control. Precipitated chromatin DNA was recovered and analyzed by qPCR.
Total RNA samples were extracted using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. RT-qPCR analysis was performed using the Ultra SYBR Mixture with ROX (CWBio, Co., Ltd., Beijing, China) and an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Inc.). HOTAIR cDNA amplification was performed under the following conditions: Initial denaturation at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 30 sec and primer annealing at 55°C for 30 sec, with a final extension step at 72°C for 60 sec. FOXC1 cDNA amplification was performed under the following conditions: Initial denaturation at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 30 sec and primer annealing at 55°C for 30 sec, with a final extension step at 72°C for 60 sec. miR-1 cDNA was amplified under the following conditions: Initial denaturation at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 10 sec and primer annealing at 57°C for 20 sec, with a final extension step at 72°C for 10 sec. The level of 18S expression was used as an internal control for messenger RNAs, while the U6 level was used as an internal control for miRs. The primers used in RT-qPCR are indicated in
The full sequence HOTAIR gene was obtained by qPCR amplification using the Ultra SYBR Mixture with ROX and an Applied Biosystems 7500 Real-Time PCR System. HOTAIR cDNA was amplified under the following conditions: Initial denaturation at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 30 sec and primer annealing at 55°C for 30 sec, with a final extension step at 72°C for 60 sec. The gene was cloned separately into the multiple cloning site of the psi-CHECK™-2 luciferase miR expression reporter vector. HepG2 cells were transfected with miR mimic, miR inhibitor, control miR, negative control (NC), negative control inhibitor (all purchased from Guangzhou Leader Bio-Technology Co., Ltd., Guangzhou, China) or empty plasmid using Lipofectamine 2000, according to the manufacturer's protocol. Nucleotide-substitution mutation analysis was conducted using direct oligomer synthesis of full sequences. All constructs were verified by sequencing. Luciferase activity was measured using the Dual Luciferase Reporter Assay System Kit (Promega Corporation, Madison, WI, USA) on an Infinite M200 luminescence reader (Tecan Group Ltd., Männedorf, Switzerland), according to the manufacturer's protocol.
All results are the average of ≥3 independent experiments from separately treated and transfected cultures. Data are expressed as the mean ± standard deviation. Statistical comparisons were performed by one-way analysis of variance. P<0.05 was considered to indicate a statistically significant difference.
HCC HepG2 and LO2 cells were cultured conventionally. Total RNA was extracted from tissues and cells using TRIzol. The relative expression levels of FOXC1, HOTAIR and miR-1 were detected by RT-qPCR. The relative level of FOXC1 and HOTAIR expression in HCC tissues and HepG2 cells was significantly higher than that in normal liver LO2 cells and adjacent carcinoma tissues (
Following Lipofectamine 2000 transfection of HepG2 cells with the lentiviral expression vector LV3-HOTAIR, cells were stained 72 h later with 0.04% trypan blue, and the cell survival rate was calculated. In the experimental group (LV3-HOTAIR), the effects on cell proliferation activity decreased significantly compared with those in the blank control and NC groups (P=0.01), indicating that LV3-HOTAIR can promote the proliferation of HepG2 cells (
HepG2 tumor xenografts were established in athymic nude mice to evaluate the effects of LV3-HOTAIR on HCC growth
Recently, numerous important TFs have been demonstrated to be involved in regulating lncRNA transcription (
The function of lncRNAs in human diseases may reflect their ability to regulate gene expression. Increasing evidence has suggested that ncRNAs may participate in the ceRNA regulatory network (
Recent evidence has suggested that ncRNAs serve an important role in cancer pathogenesis and can provide a novel insight into the biology of cancer (
HOTAIR lncRNA was introduced by Kornienko
lncRNAs regulate gene expression through a variety of mechanisms, including transcription, post-transcriptional processing, chromatin modification, genomic imprinting and regulation of protein function (
Previous studies have established that lncRNAs can also regulate other non-coding RNAs, in particular miRs, and miRNAs may have an effect on the regulation of lncRNAs (
It has been recently reported that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repressing miR-130a (
The present study was supported by the Natural Science Foundation of Guangdong Province (Guangzhou, China; grant no. 04006966).
long non-coding RNA
microRNA
small interfering RNA
transcription factor
reverse transcription-quantitative polymerase chain reaction
hepatocellular carcinoma
HOX transcript antisense intergenic RNA
forkhead bo
Relative levels of gene expression detected by reverse transcription-quantitative polymerase chain reaction. Relative expression of (A) FOXC1, (B) miR-1 and (C) HOTAIR. HOTAIR, HOX transcript antisense intergenic RNA; FOXC1, forkhead box C1; miR, microRNA; mRNA, messenger RNA.
The proliferation of HepG2 cells was determined with trypan blue exclusion assay. Data are presented as the mean ± standard deviation; n=3; *P<0.05 vs. NC group. HOTAIR, HOX transcript antisense intergenic RNA; NC, negative control.
Effect of LV3-HOTAIR on hepatocellular carcinoma xenografts. HepG2 tumor xenografts were established in male athymic nude mice. Animals in the treatment group received LV3-HOTAIR (200 nM/kg once daily). Control mice received phosphate-buffered saline (100 µl/kg once daily). NC mice received scrambled sequence (200 nM/kg once daily). After 20 daily treatments, tumors injected with LV3-HOTAIR were significantly larger than those in the control and NC groups. (A) Growth curves of tumor xenografts, ∆P<0.05 compared with control and NC groups. (B) Mice were sacrificed and their xenografts were removed for weighing. HOTAIR, HOX transcript antisense intergenic RNA; NC, negative control.
FOXC1 promotes HOTAIR expression via binding to its promoter regions. (A) ChIP assays were used to assess FOXC1 binding at the promoter region of HOTAIR containing the E-box element. The ChIP-derived DNA was amplified by quantitative polymerase chain reaction with specific primers and expressed as a percentage of input DNA. Data are presented as the mean ± standard error based on ≥3 independent experiments (*P<0.05 compared with the IgG group). (B) Levels of HOTAIR expression following the transfection of siRNA FOXC1 or scrambled siRNA into HepG2 cells (*P<0.05 compared with the NC group). (C) Levels of HOTAIR upon transfection of pFOXC1 or empty vector into HepG2 cells (*P<0.05 compared with the NC group). FOXC1, forkhead box C1; IgG, immunoglobulin G; ChIP, chromatin immunoprecipitation; HOTAIR, HOX transcript antisense intergenic RNA; NC, negative control; mRNA, messenger RNA; siRNA, small interfering RNA; p, plasmid.
HOTAIR negatively regulates the expression of miR-1 in HepG2 cells. (A) Luciferase reporter plasmid containing the HOTAIR wild type sequence or a mutant transcript. (B) Comparison of luciferase activity of plasmid-transfected cloned HOTAIR full-length transcript (∆P<0.05 vs. control and NC groups). (C) Comparison of the luciferase activity of the plasmid-transfected cloned HOTAIR mutant transcript (*P>0.05 vs. control and NC groups). (D) HepG2 cells were treated with siRNA HOTAIR for 48 h and the relative levels of miR-1 expression were analyzed by RT-qPCR (ΔP<0.05 vs. control and NC groups). (E) HepG2 cells were treated with pmiR-1 for 48 h and the relative levels of HOTAIR expression were analyzed by RT-qPCR (ΔP<0.05 vs. control and NC groups). miR, microRNA; HOTAIR, HOX transcript antisense intergenic RNA; Luc, luciferase; NC, negative control; NCI, negative control inhibitor; mRNA, messenger RNA; siRNA, small interfering RNA; p, plasmid; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
Primers for quantitative polymerase chain reaction.
Gene | Primers (5′-3′) |
---|---|
U6 | F: CTCGCTTCGGCAGCACA |
U6 | R: AACGCTTCACGAATTTGCGT |
18S | F: CCTGGATACCGCAGCTAGGA |
18S | R: AACGCTTCACGAATTTGCGT |
HOTAIR | F: CAGTGGGGAACTCTGACTCG |
HOTAIR | R: GTGCCTGGTGCTCTCTTACC |
FOXC1 | F: CTCAACGAGTGCTTCGTCAA |
FOXC1 | R: ACATGTTGTAGGAGTCCGGG |
miR-1 | F: CACTCCAGCTGGGTGGAATGTAAAGAAGTAT |
The level of expression was calculated using Cq and the 2-∆∆Cq method (16). F, forward; R, reverse; HOTAIR, HOX transcript antisense intergenic RNA; FOXC1, forkhead box C1; miR, microRNA.