OL Oncology Letters 1792-1074 1792-1082 D.A. Spandidos 10.3892/ol.2016.5295 OL-0-0-5295 Articles Evaluation of plasma microRNA levels to predict insensitivity of patients with advanced lung adenocarcinomas to pemetrexed and platinum ZhuJinghua 1 2 QiYuhua 3 WuJianzhong 4 ShiMeiqi 1 FengJifeng 1 * ChenLongbang 2 5 * Department of Medical Oncology, Jiangsu Cancer Institute and Hospital, Nanjing, Jiangsu 210002, P.R. China School of Medicine, Nanjing University, Nanjing, Jiangsu 210002, P.R. China Key Laboratories of Enteric Pathogenic Microbiology, Ministry of Health, Microbiological Laboratory, Jiangsu Center for Disease Prevention and Control, Nanjing, Jiangsu 210002, P.R. China Research Center of Clinical Oncology, Jiangsu Cancer Institute and Hospital, Nanjing, Jiangsu 210002, P.R. China Department of Medical Oncology, Jinling Hospital, Nanjing, Jiangsu 210002, P.R. China Correspondence to: Dr Longbang Chen, Department of Medical Oncology, Jinling Hospital, 315 Zhongshan East Road, Nanjing, Jiangsu 210002, P.R. China, E-mail: chenlongbang@yeah.net

Contributed equally

 12 2016 19 10 2016 12 6 4829 4837 17072015 09092016 Copyright © 2016, Spandidos Publications 2016

Pemetrexed combined with platinum is a first-line therapy used to treat patients with advanced non-small cell lung cancer (NSCLC) that exhibit negative or unknown epidermal growth factor receptor (EGFR) mutational status or anaplastic lymphoma kinase (ALK) rearrangements. Lung adenocarcinoma (LAC) is the primary type of NSCLC. In order to prevent overtreatment, it is necessary to identify patients with LAC who may not benefit from certain chemotherapies. Patients recruited in the present study (n=129) were diagnosed with advanced LAC and received first-line pemetrexed and platinum-based chemotherapy. A microRNA (miR) microarray was used to screen the plasma miR expression profiles in a screening set of eight patients prior to and following treatment. Specifically, plasma miR-25, miR-21, miR-27b, miR-326, miR-483-5p and miR-920 were selected for reverse transcription-quantitative polymerase chain reaction analysis in a training set (n=44) prior to treatment. The screening and training set patients were all non-smokers with no prior history of serious or chronic disease. The ∆∆Cq values of these miRs were compared between the group that showed benefit from pemetrexed and platinum treatment and the group that did not. Consequently, the ∆∆Cq values of miR-25, miR-21, miR-27b and miR-326 were further determined in a validation set (n=77). The results of the present study demonstrate that plasma expression levels of miR-25, miR-21, miR-27b and miR-326, in the training and validation sets prior to treatment, were significantly different between the benefit and non-benefit groups (P≤0.001). The expression of miR-25, miR-21, miR-27b and miR-326 was upregulated in the non-benefit group and this elevation was positively correlated with decreased progression-free survival (PFS; P≤0.001). In addition, the predictive power of each miR was evaluated through receiver operating characteristic curves, in which miR-25 exhibited the highest degree of accuracy (area under the curve, 0.926; 95% confidence interval, 0.881–0.971). These results indicate that overexpression of plasma miR-25, miR-21, miR-27b and miR-326, prior to treatment, in patients with advanced LAC is predictive of non-benefit from first-line pemetrexed and platinum-based chemotherapy, and is associated with decreased PFS. Among these four miRs, miR-25 exhibited the highest degree of accuracy in predicting insensitivity, suggesting it is the most promising biomarker.

 advanced lung adenocarcinoma pemetrexed platinum circulating microRNA predictive markers Introduction

Lung cancer is the primary cause of cancer-associated mortality worldwide (1) and non-small cell lung cancer (NSCLC) accounts for ~85% of all lung cancer cases. NSCLC is divided into two major types, squamous cell carcinoma and non-squamous cell carcinoma. Non-squamous cell carcinoma is comprised of a number of subtypes, including adenocarcinoma and large-cell carcinoma. Adenocarcinoma is the most frequent non-squamous cell carcinoma and its prevalence is increasing (2).

For patients with advanced NSCLC that exhibit a negative or unknown EGFR mutational status or ALK rearrangements, platinum-based double chemotherapy is the typical first-line therapy (3,4). In the treatment of non-squamous cell carcinoma, pemetrexed combined with platinum demonstrates a significantly improved toxicity profile and OS, compared with taxane- or gemcitabine-based regimes (3,5,6). Nevertheless, a number of patients do not benefit from pemetrexed and platinum-based therapy, due to insensitivity or high toxicity to the combination (7–9). Therefore, it is necessary to identify patients unlikely to benefit from this treatment in order to avoid unnecessary treatment. Previous studies have demonstrated that excision repair cross-complementation group 1 (ERCC-1), breast cancer type 1 susceptibility protein (BRCA-1), ribonucleotide reductase catalytic subunit M1 (RRM-1) and thymidylate synthase (TS) are predictive markers of the chemotherapeutic effect of platinum agents, taxanes, gemcitabine and pemetrexed (10–14). However, the predictiveness of ERCC-1, RRM-1 and BRCA-1 has not been reproducible (15–18). There is a particular need for further phase III studies of TS to validate the reproducibility of the applied immunohistochemistry and scoring systems for its use as a predictive marker (18). Consequently, it is important to identify novel biomarkers for the prediction of chemotherapeutic benefit.

MicroRNAs (miRs) are small noncoding RNAs, of between 19 and 25 nucleotides in length, which bind to the 3′-untranslated region of mRNAs to regulate their translation. miRs are involved in numerous essential biological processes and are associated with a number of types of cancer and disease (19). Numerous studies have demonstrated that miRs are dysregulated in cancer, such as that of the lung (20–23). As circulating miRs are stable in blood plasma, they have potential applications as diagnostic markers (24,25). Increasing evidence has shown circulating miR profile analysis can aid in early diagnosis, staging, tracking and prognosis of different types of cancer (26–32). In addition, circulating miR profile analysis is useful in predicting the response to chemotherapy (33,34).

The present study aimed to determine which plasma miRs may be used to predict the clinical outcome of pemetrexed and platinum treatment for advanced lung adenocarcinoma (LAC). In contrast with previous research, patient benefit to the treatment was examined instead of tumor response. Seidman et al (35) observed that the overall survival (OS) of patients with stable metastatic breast cancer resembled that of patients with complete remission (CR) or partial remission (PR), indicating that similar benefits to remission may come from stable disease (SD). Therefore, benefit (CR+PR+SD) may be deemed a more accurate indicator of treatment efficacy than tumor response (36). A miR microarray and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) were used to identify and verify potential markers in training and validation sets following screening. It was demonstrated that high plasma expression levels of miR-25, miR-21, miR-27b and miR-326 may predict non-benefit from chemotherapy, and that increased levels of these miRs was inversely correlated with progression-free survival (PFS).

 Materials and methods <sec> <title>Study participants

A total of 129 participants (Table I) diagnosed with stage IIIB-IV LAC were recruited from the Jiangsu Cancer Institute and Hospital (Nanjing, China) between September 2010 and January 2013. All patients had histological or cytological confirmation of their tumor diagnosis. Tumors were staged based on the Seventh Edition Tumor-Node-Metastasis Staging System of the American Joint Committee on Cancer (37). All patients received first-line chemotherapy, pemetrexed (500 mg/m2) on day 1 with either cisplatin (75 mg/m2) or car-boplatin [area under the curve (AUC)=5] on day 2 of a 21-day treatment cycle. All patients experienced ≥2 cycles of chemotherapy. Therapeutic response was evaluated by computed tomography following 2 cycles of treatment, according to Response Evaluation Criteria in Solid Tumors 1.1 (38). Response was classified as PR, CR, SD or progressive disease (PD). Patients classified as CR, PR or SD for ≥4 weeks were assigned to the benefit group. Conversely, patients classified as PD were assigned to the non-benefit group.

Plasma samples from all patients were collected prior to chemotherapy, between September 2010 and January 2013. A miR microarray was used to screen the plasma miR expression profiles of a screening set of eight patients prior to and following treatment. Specifically, plasma miR-25, miR-21, miR-27b, miR-326, miR-483-5p and miR-920 were selected for analysis in a training set (n=44) prior to treatment. The screening and training set patients were all non-smokers with no prior history of serious or chronic disease. Consequently, the ∆∆Cq values of miR-25, miR-21, miR-27b and miR-326 were further determined in a validation set (n=77), which included smokers and patients with a prior history of serious or chronic disease. Patients were observed until December 2014. The present study was approved by the Medical Ethics Committee of Jiangsu Cancer Institute and Hospital and all participants provided informed consent.

 Total RNA isolation

Whole blood samples (5 ml per patient) were collected in anticoagulant tubes and centrifuged at 1,811 × g for 5 min at 4°C. The supernatant was subsequently transferred into an RNase/DNase-free 1 ml microfuge tube and immediately stored at −80°C until required. As there is no established endogenous miR control for blood plasma, prior to the isolation process, cel-miR-238 (UUUGUACUCCGAUGCCAUUCAGA; Takara Biotechnology Co., Ltd., Dalian, China), a synthetic Caenorhabditis elegans miR, was mixed with every sample as an internal control, at a final concentration of 25 fmol. Separation of total RNA from the plasma was performed using the NucleoSpin miRNA Plasma kit (Machery-Nagel GmbH, Düren, Germany), according to the manufacturer's instructions. RNA purity and quantity was determined using a NanoDrop spectrophotometer (ND-1000; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

 miR microarray analysis

The isolated RNAs were labeled using the miRCURY Hy3/Hy5 Power Labeling kit (cat. no. 208520), and the Hy3TM-labeled samples were then hybridized, following the manufacturer's protocol, to the miRCURYTM LNA Array (cat. no. 208031-A) (both Exiqon A/S, Vedbaek, Denmark). This array covered miRs annotated in miRBase version 18.0 (www.mirbase.org), comprising of 3,100 capture probes, including all human, rat and mouse miR genes. Subsequently, the Axon GenePix 4000B Microarray Scanner (Molecular Devices, LLC, Sunnyvale, CA, USA) was used to scan the slides at a wavelength of 532 nm. Image files were then transferred to GenePix Pro version 6.0 software (Molecular Devices, LLC) for further analysis. Replicated miR readings were averaged and miRs with intensities ≥50 were selected for normalization using the median normalization method (39). Subsequently, fold change filtering identified differentially expressed miRs. All miR microarray analysis was performed by KangChen Bio-tech (Shanghai, China).

 Quantification and confirmation of candidate miRs using RT-qPCR

Plasma sample miRs were quantified using RT-qPCR. Briefly, 1.67 µl RNA (50 ng) was included in a 5 µl reaction mixture using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) and a RT primer (TaqMan® MicroRNA Assay; Applied Biosystems; Thermo Fisher Scientific, Inc.) to convert miRNA to cDNA. The RT thermocycling conditions were as follows: 30 min at 16°C; 30 min at 42°C; 5 min at 85°C; and 4°C until required. Subsequently, qPCR was carried out in a volume of 10 µl containing 4.5 µl diluted cDNA (1:15), 5 µl TaqMan Universal PCR Master Mix (No AmpErase UNG), AmpliTaq Gold® DNA Polymerase and 0.5 µl PCR probes (TaqMan® MicroRNA Assay; Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was performed using a 7900 Fast Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR thermocycling conditions were as follows: 10 min at 95°C; 40 cycles of 95°C for 15 sec; and 60°C for 1 min. Each sample was run in duplicate and the mean Cq value was determined. The relative miRs expression level (Log2 relative expression level) was calculated using the 2-∆∆Cq method (40), where ∆Cq was calculated as follows: Cq (target miR)-Cq (cel-miR-238).

 Statistical analysis

Fisher's exact test, a two-sided χ2 test and Pearson's χ2 test were used to evaluate differences in the clinicopathological factors between groups. To compare the expression levels of different miRs between the benefit and non-benefit groups, the Mann-Whitney U test was used. To estimate the diagnostic potential of plasma miRs, receiver-operating characteristics (ROC) curves were produced. The predictive power was estimated by calculating the AUC of the ROCs, and the maximum value of the Youden's index was used as a criterion for selecting the optimum cut-off point (41). The Kaplan-Meier estimator was used to evaluate PFS and compare log rank statistics. SPSS software (version 19.0; IBM SPSS, Armonk, NY, USA) was used for statistical analysis. Results are presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Patient characteristics

Patient characteristics are presented in Table I. The demographics and clinical characteristics of patients in the benefit and non-benefit groups were similar in regards to age, gender, smoking status, tumor stage, EGFR/ALK state, prior serious/chronic disease history and Karnofsky performance status score. The relative dose intensity of each drug was the real dose (actual dose used): Ideal dose (the dose planned) ratio. PFS time was calculated from the date of initiation of chemotherapy to the date of the last follow-up, to the date of detected progression or date of death owing to any cause. Among the patients, 13 could not be evaluated for PFS due to requiring further radiotherapy or being untraceable for follow-ups.

 miR expression profiles in the plasma of patients with LAC prior to and following chemotherapy

miR expression profiles were assessed in 8 patients (benefit group, n=4; non-benefit group, n=4), prior to and following treatment, in duplicate, to give a total of 16 plasma samples. The results showed that, prior to treatment, there were 312 upregulated miRs (fold change ≥2.0) in the benefit group and 233 upregulated miRs in the non-benefit group. Following treatment, there were 213 upregulated and 186 downregulated miRs in the benefit group, and 188 upregulated and 157 downregulated miRs in the non-benefit group. The miRs selected for further confirmation by RT-qPCR displayed the following: A 10-fold change in expression between the benefit and non-benefit groups; >2-fold change in expression in the same group between pre- and post-treatment; and an association with cancer in published literature. A total of 6 of the differentially expressed miRs (miR-483-5p, miR-920, upregulated in the benefit group; miR-21, miR-27b, miR-326, miR-25, upregulated in the non-benefit group) were further analyzed. Relative expressions of these 6 miRs are listed in Table II.

 miR expression in the training set

RT-qPCR was used to confirm the expression levels of 6 candidate miRs in a training set (benefit, n=29; non-benefit, n=15). To avoid the effect of compounding factors, all patients recruited were non-smokers with no prior history of serious or chronic disease. The ∆∆Cq values and relative expression levels of the candidate miRs was calculated (Fig. 1A), confirming the screening results of miR-25, miR-27b, miR-21 and miR-326. However, the relative expression levels of miR-483-5p and miR-920 were inconsistent with the results of the microarray (data not shown). As shown in Fig. 1A, the ∆∆Cq values of miR-25, miR-27b, miR-21 and miR-326 in patient plasma prior to treatment were significantly increased in the benefit group compared with the non-benefit group (P<0.001). Therefore, miR-25, miR-27b, miR-21 and miR-326 were selected for further validation.

 Confirmation of miR expression in the validation set

As shown in Fig. 1B, the ∆∆Cq values of plasma miR-25, miR-27b, miR-21 and miR-326 prior to treatment were compared between the benefit and non-benefit groups in a validation set (benefit, n=51; non-benefit, n=26). The ∆∆Cq values of these 4 miRs were significantly upregulated in the benefit group compared with the non-benefit group (P≤0.001; Fig. 1B). In addition, the trend in the alteration of relative expression levels was similar to that seen in the training set.

 Evaluation of the diagnostic potential of the candidate miRs

ROC curve analysis was performed on miR-25, miR-27b, miR-21 and miR-326 in 121 patients to evaluate their suitability as predictive biomarkers of pemetrexed and platinum insensitivity (Fig. 2). The AUC of miR-25 was 0.926 [95% confidence interval (CI), 0.881–0.971], which was the highest of the four miRs tested. The AUCs of miR-21, miR-27b and miR-326 were 0.905 (95% CI, 0.845–0.964), 0.817 (95% CI, 0.733–0.900) and 0.803 (95% CI, 0.717–0.890), respectively. The optimal cut-off points were-0.171 (sensitivity, 91.3%; specificity, 80.5%) for miR-25, 0.568 (sensitivity, 82.5%; specificity, 73.2%) for miR-27b, −1.85 (sensitivity, 82.5%; specificity, 85.4%) for mir-21 and 3.05 (sensitivity, 90.0%; specificity, 63.4%) for mir-326. miR-25 exhibited the most accurate predictive power.

 Prediction of PFS rate using plasma miR expression levels

The association between plasma miR expression levels and PFS rate in 108 patients (benefit group, n=67; non-benefit group, n=41) was investigated. As shown in Fig. 3, the expression levels of miR-25, miR-27b, miR-21 and miR-326 had a significant effect on the PFS rate (all P≤0.001, high miR expression vs. low miR expression). Plasma miR expression levels were inversely correlated with PFS, indicating that increased expression of these miRs is associated with decreased PFS.

 Discussion

It is well established that miRs are stable in the blood, and that circulating miRs may act as biomarkers for early diagnosis and prognosis of human cancer (24–32). Likewise, clinical studies have demonstrated that circulating miRs may serve as predictors of resistance to anticancer agents (33,34). In the present study, plasma miR profiles were compared between benefit and non-benefit groups in order to identify candidate circulating biomarkers that may be used to predict non-benefit from first-line pemetrexed and platinum therapy in patients with advanced LAC.

The expression profile of circulating miRs differs markedly between individuals, disease states, types of cancer and tissues. In the present study, to prevent the influence of this diversity, patient plasma was compared prior to and following chemotherapy using a microarray to measure target miR expression levels. To avoid the compounding effect of nicotine, which may alter the miR expression (42), and comorbidities, including diabetes and hypertension, patients exhibiting these characteristics were excluded from the screening and the training sets. The results in the training set were repeatable in the validation set.

From the results of the miR microarray screening, 6 miRs were selected for further analysis using RT-qPCR. It was observed that in the training and validation sets, the plasma expression levels of miR-25, miR-21, miR-27b and miR-326 prior to treatment were significantly upregulated in the non-benefit group compared with the benefit group. Furthermore, increased expression of these four miRs was associated with poor PFS. The predictive power of each miR was evaluated using ROC curves, in which miR-25 exhibited the highest degree of accuracy (AUC, 0.926; 95% CI, 0.881–0.971). Among these four miRs, miR-21 is recognized as a marker of reduced therapeutic response and decreased survival in patients with lung cancer (43–45). In addition, miR-21 is associated with multidrug resistance (46), particularly to platinum in NSCLC (47). In the present study, plasma miR-21 expression levels were upregulated in the non-benefit group compared with the benefit group, and high expression of miR-21 was associated with poor PFS.

miR-25 is known to be dysregulated in various types of cancer, and to have oncogenic and tumor suppressive functions (48,49). In NSCLC cell lines and human tissue, miR-25 expression is significantly increased compared with normal lung cells or adjacent non-cancerous tissues, respectively (50). Downregulation of miR-25 may increase cisplatin sensitivity and suppress the growth of NSCLC cells in vivo (51). Furthermore, increased miR-25 expression has been associated with poor OS in non-smoking females with LAC (52). The results of the present study demonstrate that miR-25 is significantly upregulated in the blood plasma of patients with LAC in the non-benefit group compared with the benefit group, and that high plasma miR-25 expression is associated with decreased PFS.

The expression level of miR-27b varies between different types of cancer. miR-27b may be upregulated or downregulated in chemoresistant cancer cells and tumor samples (53–55). High expression levels of miR-27b in a number of cancer samples have been reported to be associated with good or bad prognoses (56,57). In previous studies miR-27b was found to be downregulated in several NSCLC cell lines and lung cancer tissues (58,59). In the present study, plasma miR-27b was demonstrated to be significantly upregulated in patients with LAC in the non-benefit group compared with the benefit group, and high plasma expression of miR-27b was associated with decreased PFS. Shen et al (60) reported that a number of miRs did not exhibit similar expression patterns in plasma and tumor tissue samples, suggesting that miR expression may be altered by host-derived factors in response to the tumor and metastases, in addition to by the tumor directly.

miR-326 is a suppressor of the Hedgehog, Notch and mitogen-activated protein kinase signaling pathways that are associated with brain tumors (61–63), and may block expression of multidrug resistance-associated proteins in breast cancer (64). Low expression levels of miR-326 are correlated with poor OS in patients with pathological grade III–IV glioma (65). In addition, miR-326 expression was shown to be downregulated in metastatic compared with non-metastatic primary loci in nude mouse NSCLC cells (66). Therefore, it may be possible to use miR-326 expression levels to monitor bone metastasis in patients with LAC (67). The results of the present study are consistent with a previous study, which demonstrated that high plasma expression of miR-27b, miR-148a and miR-326 prior to treatment with 5-fluorouracil and oxaliplatin was correlated with decreased PFS in patients with metastatic colorectal cancer (68).

In the current study, the EGFR genotype of the majority of patients was unknown. Previous studies have identified an interaction between EGFR and miRs (69). For instance, miR-21 is positively regulated by EGFR in cancer cells (70) and the gene encoding EGFR is a potential target of miR-23b/27b (71). Therefore, EGFR genotype status may influence miR expression levels. In the present study, the EGFR genotype status (known or unknown) was similar in the non-benefit and benefit groups, which may have reduced this effect to a certain extent.

In conclusion, the results of the present study demonstrate that overexpression of plasma miR-25, miR-21, miR-27b and miR-326 in patients with advanced LAC is predictive of non-benefit to pemetrexed and platinum therapy, and that increased expression of these miRs is associated with decreased PFS. Among these miRs, miR-25 exhibited the highest degree of accuracy in predicting non-benefit, indicating that it is the most promising biomarker. The results of the current study suggest that plasma miRs may be used as minimally invasive independent molecular biomarkers to predict non-benefit from chemotherapy and PFS rates in patients with advanced LAC.

 Acknowledgements

The authors thank Professor Tingting Wang of the Immunology and Reproduction Biology Laboratory of Nanjing University for her advice.

 References TorreLABrayFSiegelRLFerlayJLortet-TieulentJJemalAGlobal cancer statistics, 2012CA Cancer J Clin6587108201510.3322/caac.2126225651787 ParkinDMBrayFFerlayJPisaniPGlobal cancer statistics, 2002CA Cancer J Clin5574108200510.3322/canjclin.55.2.7415761078 ScagliottiGVParikhPvon PawelJBiesmaBVansteenkisteJManegoldCSerwatowskiPGatzemeierUDigumartiRZukinMPhase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancerJ Clin Oncol2635433551200810.1200/JCO.2007.15.037518506025 LeeJKHahnSKimDWSuhKJKeamBKimTMLeeSHHeoDSEpidermal growth factor receptor tyrosine kinase inhibitors vs conventional chemotherapy in non-small cell lung cancer harboring wild-type epidermal growth factor receptor: A meta-analysisJAMA31114301437201410.1001/jama.2014.331424715074 ScagliottiGBrodowiczTShepherdFAZielinskiCVansteenkisteJManegoldCSimmsLFossellaFSugarmanKBelaniCPTreatment-by-histology interaction analyses in three phase III trials show superiority of pemetrexed in nonsquamous non-small cell lung cancerJ Thorac Oncol66470201110.1097/JTO.0b013e3181f7c6d421119545 PennellNASelection of chemotherapy for patients with advanced non-small cell lung cancerCleve Clin J Med79Electronic (Suppl 1)eS46eS50201210.3949/ccjm.78.s2.1022614966 KimYHHirabayashiMTogashiYHiranoKTomiiKMasagoKKanedaTYoshimatsuHOtsukaKMioTPhase II study of carboplatin and pemetrexed in advanced non-squamous, non-small-cell lung cancer: Kyoto thoracic oncology research group trial 0902Cancer Chemother Pharmacol70271276201210.1007/s00280-012-1910-222752216 HartmannJTLippHPToxicity of platinum compoundsExpert Opin Pharmacother4889901200310.1517/14656566.4.6.88912783586 GotaVKavathiyaKDoshiKGurjarMDamodaranSENoronhaVJoshiAPrabhashKHigh plasma exposure to pemetrexed leads to severe hyponatremia in patients with advanced non small cell lung cancer receiving pemetrexed-platinum doublet chemotherapyCancer Manag Res6261265201424940080 OlaussenKADunantAFouretPBrambillaEAndréFHaddadVTaranchonEFilipitsMPirkerRPopperHHDNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapyN Engl J Med355983991200610.1056/NEJMoa06057016957145 CoboMIslaDMassutiBMontesASanchezJMProvencioMViñolasNPaz-AresLLopez-VivancoGMuñozMACustomizing cisplatin based on quantitative excision repair cross-complementing 1 mRNA expression: A phase III trial in non-small-cell lung cancerJ Clin Oncol2527472754200710.1200/JCO.2006.09.791517602080 BoukovinasIPapadakiCMendezPTaronMMavroudisDKoutsopoulosASanchez-RoncoMSanchezJJTrypakiMStaphopoulosETumor BRCA1, RRM1 and RRM2 mRNA expression levels and clinical response to first-line gemcitabine plus docetaxel in non-small-cell lung cancer patientsPLoS One3e3695200810.1371/journal.pone.000369519002265 CarserJEQuinnJEMichieCOO'BrienEJMcCluggageWGMaxwellPLamersELioeTFWilliamsARKennedyRDBRCA1 is both a prognostic and predictive biomarker of response to chemotherapy in sporadic epithelial ovarian cancerGynecol Oncol123492498201110.1016/j.ygyno.2011.08.01721920589 NicolsonMCFennellDAFerryDO'ByrneKShahRPotterVSkailesGUpadhyaySTaylorPAndréVThymidylate synthase expression and outcome of patients receiving pemetrexed for advanced nonsquamous non-small-cell lung cancer in a prospective blinded assessment phase II clinical trialJ Thorac Oncol8930939201310.1097/JTO.0b013e318292c50023722170 FribouletLOlaussenKAPignonJPShepherdFATsaoMSGrazianoSKratzkeRDouillardJYSeymourLPirkerRERCC1 isoform expression and DNA repair in non-small-cell lung cancerN Engl J Med36811011110201310.1056/NEJMoa121427123514287 BeplerGWilliamsCSchellMJChenWZhengZSimonGGadgeelSZhaoXSchreiberFBrahmerJRandomized international phase III trial of ERCC1 and RRM1 expression-based chemotherapy versus gemcitabine/carboplatin in advanced non-small-cell lung cancerJ Clin Oncol3124042412201310.1200/JCO.2012.46.978323690416 MoranTWeiJCoboMQianXDomineMZouZBoverIWangLProvencioMYuLTwo biomarker-directed randomized trials in European and Chinese patients with nonsmall-cell lung cancer: The BRCA1-RAP80 Expression Customization (BREC) studiesAnn Oncol2521472155201410.1093/annonc/mdu38925164908 KerrKMBubendorfLEdelmanMJMarchettiAMokTNovelloSO'ByrneKStahelRPetersSFelipEPanel Members; Panel Members: Second ESMO consensus conference on lung cancer: Pathology and molecular biomarkers for non-small-cell lung cancerAnn Oncol2516811690201410.1093/annonc/mdu14524718890 LewisBPBurgeCBBartelDPConserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targetsCell1201520200510.1016/j.cell.2004.12.03515652477 FaraziTASpitzerJIMorozovPTuschlTmiRNAs in human cancerJ Pathol223102115201110.1002/path.280621125669 WangJTianXHanRZhangXWangXShenHXueLLiuYYanXShenJDownregulation of miR-486-5p contributes to tumor progression and metastasis by targeting protumorigenic ARHGAP5 in lung cancerOncogene3311811189201410.1038/onc.2013.4223474761 FuseMKojimaSEnokidaHChiyomaruTYoshinoHNohataNKinoshitaTSakamotoSNayaYNakagawaMTumor suppressive microRNAs (miR-222 and miR-31) regulate molecular pathways based on microRNA expression signature in prostate cancerJ Hum Genet57691699201210.1038/jhg.2012.9522854542 SelcukluSDDonoghueMTSpillaneCmiR-21 as a key regulator of oncogenic processesBiochem Soc Trans37918925200910.1042/BST037091819614619 ChenXBaYMaLCaiXYinYWangKGuoJZhangYChenJGuoXCharacterization of microRNAs in serum: A novel class of biomarkers for diagnosis of cancer and other diseasesCell Res189971006200810.1038/cr.2008.28218766170 MitchellPSParkinRKKrohEMFritzBRWymanSKPogosova-AgadjanyanELPetersonANoteboomJO'BriantKCAllenACirculating microRNAs as stable blood-based markers for cancer detectionProc Natl Acad Sci USA1051051310518200810.1073/pnas.080454910518663219 RabinowitsGGerçel-TaylorCDayJMTaylorDDKloeckerGHExosomal microRNA: A diagnostic marker for lung cancerClin Lung Cancer104246200910.3816/CLC.2009.n.00619289371 HuangZHuangDNiSPengZShengWDuXPlasma microRNAs are promising novel biomarkers for early detection of colorectal cancerInt J Cancer127118126201010.1002/ijc.2500719876917 ToiyamaYHurKTanakaKInoueYKusunokiMBolandCRGoelASerum miR-200c is a novel prognostic and metastasis-predictive biomarker in patients with colorectal cancerAnn Surg259735743201410.1097/SLA.0b013e3182a6909d23982750 EichelserCFlesch-JanysDChang-ClaudeJPantelKSchwarzenbachHDeregulated serum concentrations of circulating cell-free microRNAs miR-17, miR-34a, miR-155, and miR-373 in human breast cancer development and progressionClin Chem5914891496201310.1373/clinchem.2013.20516123748853 ZhuCRenCHanJDingYDuJDaiNDaiJMaHHuZShenHA five-microRNA panel in plasma was identified as potential biomarker for early detection of gastric cancerBr J Cancer11022912299201410.1038/bjc.2014.11924595006 YangCWangCChenXChenSZhangYZhiFWangJLiLZhouXLiNIdentification of seven serum microRNAs from a genome-wide serum microRNA expression profile as potential noninvasive biomarkers for malignant astrocytomasInt J Cancer132116127201310.1002/ijc.2765722674182 ZhengHZhangLZhaoYYangDSongFWenYHaoQHuZZhangWChenKPlasma miRNAs as diagnostic and prognostic biomarkers for ovarian cancerPLoS One8e77853201310.1371/journal.pone.007785324223734 NolenBMMarksJRTa'sanSRandALuongTMWangYBlackwellKLokshinAESerum biomarker profiles and response to neoadjuvant chemotherapy for locally advanced breast cancerBreast Cancer Res10R45200810.1186/bcr209618474099 HansenTFSørensenFBLindebjergJJakobsenAThe predictive value of microRNA-126 in relation to first line treatment with capecitabine and oxaliplatin in patients with metastatic colorectal cancerBMC Cancer1283201210.1186/1471-2407-12-8322397399 SeidmanADO'ShaughnessyJMissetJLSingle-agent capecitabine: A reference treatment for taxane-pretreated metastatic breast cancerOncologist 7: (Suppl 6)2028200210.1634/theoncologist.7-suppl_6-20 CecchinEInnocentiFD'AndreaMCoronaGDe MattiaEBiasonPBuonadonnaAToffoliGPredictive role of the UGT1A1, UGT1A7, and UGT1A9 genetic variants and their haplotypes on the outcome of metastatic colorectal cancer patients treated with fluorouracil, leucovorin, and irinotecanJ Clin Oncol2724572465200910.1200/JCO.2008.19.031419364970 EdgeSByrdDRComptonCCFritzAGGreeneFLTrottiAAJCC Cancer Staging Manual7thSpringer-VerlagNew York, NY2010 EisenhauerEATherassePBogaertsJSchwartzLHSargentDFordRDanceyJArbuckSGwytherSMooneyMNew response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1)Eur J Cancer45228247200910.1016/j.ejca.2008.10.02619097774 ChurchillGAFundamentals of experimental design for cDNA microarraysNat Genet32(Suppl)490495200210.1038/ng103112454643 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) MethodMethods25402408200110.1006/meth.2001.126211846609 YoudenWJIndex for rating diagnostic testsCancer33235195010.1002/1097-0142(1950)3:1<32::AID-CNCR2820030106>3.0.CO;2-315405679 NgTKCarballosaCMPelaezDWongHKChoyKWPangCPCheungHSNicotine alters MicroRNA expression and hinders human adult stem cell regenerative potentialStem Cells Dev22781790201310.1089/scd.2012.043423030247 LiuZLWangHLiuJWangZXMicroRNA-21 (miR-21) expression promotes growth, metastasis, and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTENMol Cell Biochem3723545201310.1007/s11010-012-1443-322956424 GaoWLuXLiuLXuJFengDShuYMiRNA-21: A biomarker predictive for platinum-based adjuvant chemotherapy response in patients with non-small cell lung cancerCancer Biol Ther13330340201210.4161/cbt.1907322237007 LiuXGZhuWYHuangYYMaLNZhouSQWangYKZengFZhouJHZhangYKHigh expression of serum miR-21 and tumor miR-200c associated with poor prognosis in patients with lung cancerMed Oncol29618626201210.1007/s12032-011-9923-y21516486 DongZRenLLinLLiJHuangYLiJEffect of microRNA-21 on multidrug resistance reversal in A549/DDP human lung cancer cellsMol Med Rep11682690201525323306 XuLHuangYChenDHeJZhuWZhangYLiuXDownregulation of miR-21 increases cisplatin sensitivity of non-small-cell lung cancerCancer Genet207214220201410.1016/j.cancergen.2014.04.00324906642 ZhangHZuoZLuXWangLWangHZhuZMiR-25 regulates apoptosis by targeting Bim in human ovarian cancerOncol Rep27594598201222076535 LiQZouCZouCHanZXiaoHWeiHWangWZhangLZhangXTangQMicroRNA-25 functions as a potential tumor suppressor in colon cancer by targeting Smad7Cancer Lett335168174201310.1016/j.canlet.2013.02.02923435373 YangTChenTLiYGaoLZhangSWangTChenMDownregulation of miR-25 modulates non-small cell lung cancer cells by targeting CDC42Tumour Biol3619031911201510.1007/s13277-014-2793-025432132 YangTChenTLiYGaoLZhangSWangTChenMDownregulation of miR-25 modulates non-small cell lung cancer cells by targeting CDC42Tumour Biol3619031911201510.1007/s13277-014-2793-025432132 XuFXSuYLZhangHKongJYYuHQianBYPrognostic implications for high expression of MiR-25 in lung adenocarcinomas of female non-smokersAsian Pac J Cancer Prev1511971203201410.7314/APJCP.2014.15.3.119724606441 RasmussenMHJensenNFTarpgaardLSQvortrupCRømerMUStenvangJHansenTPChristensenLLLindebjergJHansenFHigh expression of microRNA-625-3p is associated with poor response to first-line oxaliplatin based treatment of metastatic colorectal cancerMol Oncol7637646201310.1016/j.molonc.2013.02.01623506979 ParkYTJeongJYLeeMJKimKIKimTHKwonYDLeeCKimOJAnHJMicroRNAs overexpressed in ovarian ALDH1-positive cells are associated with chemoresistanceJ Ovarian Res618201310.1186/1757-2215-6-1823522567 BeraAVenkataSubbaRaoKManoharanMSHillPFreemanJWA miRNA signature of chemoresistant mesenchymal phenotype identifies novel molecular targets associated with advanced pancreatic cancerPLoS One9e106343201410.1371/journal.pone.010634325184537 BuffaFMCampsCWinchesterLSnellCEGeeHESheldonHTaylorMHarrisALRagoussisJmicroRNA-associated progression pathways and potential therapeutic targets identified by integrated mRNA and microRNA expression profiling in breast cancerCancer Res7156355645201110.1158/0008-5472.CAN-11-048921737487 GotoYKojimaSNishikawaREnokidaHChiyomaruTKinoshitaTNakagawaMNayaYIchikawaTSekiNThe microRNA-23b/27b/24-1 cluster is a disease progression marker and tumor suppressor in prostate cancerOncotarget577487759201410.18632/oncotarget.229425115396 JiangJLvXFanLHuangGZhanYWangMLuHMicroRNA-27b suppresses growth and invasion of NSCLC cells by targeting Sp1Tumour Biol351001910023201410.1007/s13277-014-2294-125012245 YanaiharaNCaplenNBowmanESeikeMKumamotoKYiMStephensRMOkamotoAYokotaJTanakaTUnique microRNA molecular profiles in lung cancer diagnosis and prognosisCancer Cell9189198200610.1016/j.ccr.2006.01.02516530703 ShenJToddNWZhangHYuLLingxiaoXMeiYGuarneraMLiaoJChouALuCLPlasma microRNAs as potential biomarkers for non-small-cell lung cancerLab Invest91579587201110.1038/labinvest.2010.19421116241 KefasBComeauLFloydDHSeleverstovOGodlewskiJSchmittgenTJiangJdiPierroCGLiYChioccaEAThe neuronal microRNA miR-326 acts in a feedback loop with notch and has therapeutic potential against brain tumorsJ Neurosci291516115168200910.1523/JNEUROSCI.4966-09.200919955368 FerrettiEDe SmaeleEMieleELanevePPoAPelloniMPaganelliADi MarcotullioLCaffarelliEScrepantiIConcerted microRNA control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cellsEMBO J2726162627200810.1038/emboj.2008.17218756266 ZhouJXuTYanYQinRWangHZhangXHuangYWangYLuYFuDChenJMicroRNA-326 functions as a tumor suppressor in glioma by targeting the Nin one binding protein (NOB1)PLoS One8e68469201310.1371/journal.pone.006846923869222 LiangZWuHXiaJLiYZhangYHuangKWagarNYoonYChoHTScalaSShimHInvolvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1Biochem Pharmacol79817824201010.1016/j.bcp.2009.10.01719883630 WangSLuSGengSMaSLiangZJiaoBExpression and clinical significance of microRNA-326 in human glioma miR-326 expression in gliomaMed Oncol30373201310.1007/s12032-012-0373-y23292865 WangRChenXFShuYQPrediction of non-small cell lung cancer metastasis-associated microRNAs using bioinformaticsAm J Cancer Res532512014eCollection 201525628919 ValenciaKMartín-FernándezMZanduetaCOrmazábalCMartínez-CanariasSBandrésEde la PiedraCLecandaFmiR-326 associates with biochemical markers of bone turnover in lung cancer bone metastasisBone52532539201310.1016/j.bone.2012.10.03323142363 KjersemJBIkdahlTLingjaerdeOCGurenTTveitKMKureEHPlasma microRNAs predicting clinical outcome in metastatic colorectal cancer patients receiving first-line oxaliplatin-based treatmentMol Oncol85967201410.1016/j.molonc.2013.09.00124119443 GomezGGWykoskyJZancaCFurnariFBCaveneeWKTherapeutic resistance in cancer: microRNA regulation of EGFR signaling networksCancer Biol Med10192205201324349829 SeikeMGotoAOkanoTBowmanEDSchetterAJHorikawaIMatheEAJenJYangPSugimuraHGemmaAKudohSCroceCMHarrisCCMiR-21 is an EGFR-regulated anti-apoptotic factor in lung cancer in never-smokersProc Natl Acad Sci USA1061208512090200910.1073/pnas.090523410619597153 ChiyomaruTSekiNInoguchiSIshiharaTMatakiHMatsushitaRGotoYNishikawaRTataranoSItesakoTDual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancerInt J Oncol46487496201525405368

Box-plots of plasma miR-25, miR-27b, miR-21 and miR-326 expression ∆∆Cq values of the non-benefit and benefit groups in the (A) training set (n=44), and (B) validation set (n=77). Plasma miR expression levels were analyzed by reverse transcription-quantitative polymerase chain reaction analysis and ∆∆Cq values were compared using the Mann-Whitney U test. ∆∆Cq values for the 4 plasma miRs, prior to treatment, were significantly upregulated in the benefit group compared with the non-benefit group, in the training set and validation sets (ο, outlier; *, abnormal value). Outliers: the deviation between the measured value and the average value is less than two times the standard deviation; abnormal: the deviation between the measured value and the average value is more than two times the standard deviation. miR, microRNA; N, non-benefit group; B, benefit group.

Receiver operating characteristic curves of (A) miR-25, (B) miR-21, (C) miR-27b and (D) miR-326, of the non-benefit and benefit groups. miR-25 showed the highest degree of accuracy (AUC, 0.926). miR, microRNA; AUC, area under the curve.

Kaplan-Meier estimation of the progression-free survival of patients with advanced lung adenocarcinoma according to the plasma expression of specific miRs in 108 patients. (A) miR-25, (B) miR-21, (C) miR-27b and (D) miR-326. Increased miR expression levels were associated with decreased progression-free survival. miR, microRNA.

Demographic and clinical characteristics of the non-benefit and benefit groups.

Profiling set Testing set Validation set
Characteristic Non-benefit Benefit Non-benefit Benefit P-value Non-benefit Benefit P-value
Number of patients 4 4 15 29 26 51
Mean age, (years ± standard error)   43±1.2 45±4.4 55±10.1 56±8.8 0.717a 60±10.1 55±11.2 0.159a
Gender (no.)
  Male 3 3 10 18 0.764b 18 31 0.466b
  Female 1 1 5 11 8 20
Stage of LAC
  IIIB 0 0 2 3 1.000c 3 7 0.617c
  IV 4 4 13 26 23 44
Smoking status
  Yes 0 0 0 0 10 21 0.818b
  No 4 4 15 29 16 30
EGFR genotype
  Wild-type 1 0 1 3 1.000c 4 5 0.477c
  Unknown 3 4 14 26 22 46
Prior serious or chronic disease history
  Yes 0 0 0 0 11 22 0.945b
  No 4 4 15 29 15 29
KPS score
  ≥80 4 4 15 29 26 51
  <80 0 0 0 0 0 0
Relative dose intensity (%)
  Pemetrexed 100.0 97.0 98.0 97.7 98.5 97.6
  Carboplatin 71.5 62.5 91.0 78.7 87.2 86.1
  Cisplatin 87.0 100.0 93.2 92.6 94.1 91.6
Maintenance therapy
  Yes 0 2 0 19 0 24
  No 4 2 15 10 26 27

Two-sided χ2 test

Pearson's χ2 test

Fisher's exact test. LAC, lung adenocarcinoma; EGFR, epidermal growth factor receptor; KPS, Karnofsky performance status.

Relative plasma expression of miRNAs from microarray analysis.

Relative plasma expression (fold change)
miR type B prior to treatment: NB prior to treatment B prior to treatment: B following treatment NB prior to treament: NB following treatment
miR-21 0.018830 16.524080 0.474396
miR-27b 0.013600 40.662910 <2.000000
miR-326 0.030405 <2.000000 0.483120
miR-25 0.093175 12.106610 <2.000000
miR-483-5p 17.768710 0.109332 4.362240
miR-920 22.678370 0.027606 2.048308

miR, microRNA; B, benefit; NB, non-benefit.