Contributed equally
Non-small cell lung cancer (NSCLC) is the leading cause of cancer-related mortality in the world. Late diagnosis is one of the most significant reasons for the high mortality rate of lung cancer. The identification of microRNAs (miRNAs) has opened a new field for molecular diagnosis of cancer. The purpose of the present study was to investigate whether plasma miRNAs may be used as biomarkers for early-stage NSCLC. A total of 232 participants, including 149 NSCLC patients and 83 healthy controls, were recruited between July 2012 and May 2014. We measured the levels of 10 miRNAs (miR-30d, miR-383, miR-20a, miR-145, miR-221, miR-25, miR-223, miR-21, miR-126 and miR-210) in plasma samples of 40 individuals (20 patients and 20 matched healthy controls) at the point of identification of disease, and 129 NSCLC patients and 83 healthy controls at the validation stage using reverse transcription-quantitative polymerase chain reaction. Receiver operating characteristics (ROC) curves were generated for each possible combination of the miRNAs. We observed that the expression of plasma miR-145, miR-20a, miR-21 and miR-223 was significantly increased in the early-stage NSCLC samples compared with controls. miRNAs have significant diagnostic value for early-stage NSCLC. Combined ROC analyses using these four miRNAs revealed an elevated area under the ROC curve (AUC) of 0.897, with a sensitivity and specificity of 81.8 and 90.1%, respectively. This AUC helped in distinguishing early-stage NSCLC. Furthermore, the levels of the four plasma miRNAs were significantly decreased following surgery (P<0.05). Altered expression of miR-145, miR-20a, miR-21 and miR-223 in plasma are of tumor origin, and the four miRNAs may represent potential novel non-invasive biomarkers for early-stage NSCLC.
Lung cancer is the leading cause of cancer-related mortality worldwide (
Currently, histological examination is still the gold standard for the diagnosis of NSCLC. However, in this approach it is necessary to obtain tissues or cells from patients, and invasive examination methods are required, including bronchoscopy, lung puncture, endobronchial ultrasound or thoracotomy. Although chest X-ray and computed tomography examinations are capable of detecting early-stage NSCLC, certain studies have demonstrated that 50% of pulmonary nodules detected by these approaches are benign (
microRNAs (miRNAs) are a class of highly conserved non-coding small RNAs, consisting of 20–24 nt and existing widely in eukaryotic cells. The first miRNA was identified in the mutant of
All 232 participants were recruited from Shanghai Chest Hospital, China, between July 2012 and May 2014. In the training set, we selected 20 early-stage NSCLC patients and 20 age- and gender-matched healthy controls to compare the expression profile of candidate plasma miRNAs between NSCLC patients and healthy controls. In the validation set, 109 early-stage NSCLC patients and 63 healthy controls were recruited. To increase the number of samples for validation, we merged the 40 cases of samples in the screening stage with those in the validation stage. To investigate whether the altered expression of the valuable diagnostic miRNAs in plasma was of tumor origin, their expression levels were measured in an independent set of 20 cases with early-stage NSCLC. The inclusion criteria for NSCLC patients included: i) no previous history of cancer-related diseases; ii) did not receive radiotherapy or chemotherapy prior to surgery; iii) diagnosed as NSCLC pathologically following surgery; iv) I and II stages of NSCLC according to the tumor-node-metastasis (TNM) staging guidelines of the American Joint Committee on Cancer (7th version) (
Whole blood (4 ml) was added to an ethylenediamine tetraacetic acid (EDTA)-treated anticoagulant tube, and then plasma was isolated by centrifugation at 1,200 rpm for 10 min and subsequently at 12,000 rpm for 10 min at 4°C. A total of 400 µl plasma was added to an equal volume of TRIzol. After putting on ice for 5 min, 800 µl chloroform was added and incubated on ice for 5 min. Following centrifugation at 1,200 rpm for 10 min at 4°C, the supernatant was collected. In order to obtain a suitable internal control following the isolation of miRNAs, we added cel-miR-39 (Takara Biological Engineering Co., Ltd., Dalian, China) to the supernatant as reported previously (
To select an appropriate internal control, we examined the expression levels of miR-16 and RNU6B in the plasma of 20 cases of NSCLC patients and 20 age- and gender-matched healthy individuals, as described previously (
Reverse transcription was performed using a TaqMan microRNA reverse transcription kit (Ambion Life Technologies), and qPCR was performed using a Brilliant III Ultra-Fast SYBR-Green qPCR master mix kit (Ambion Life Technologies). RT-PCR was performed as described previously by Kroh
In accordance with previous studies, we selected 10 miRNAs (miR-30d, miR-383, miR-20a, miR-145, miR-221, miR-25, miR-223, miR-21, miR126 and miR-210) (
Differences in miRNA levels between cases and controls were assessed by the Mann-Whitney U test or the Kruskall-Wallis test. The Chi-square test and one-way analysis of variance were used to assess the difference in clinicopathological characteristics and association between miRNA levels and clinicopathological characteristics between cases and controls. The multivariate logistic regression model was used to establish the optimum regression equation and calculate the odds ratio and 95% confidence interval for each variable. An ROC curve was established to interpret the ability of miRNA in discriminating patients from healthy controls. The area under the curve (AUC), sensitivity and specificity at the optimal cut-off were computed in order to validate the diagnostic application of these effective miRNAs as cancer biomarkers. All P-values were shown bilaterally, and a value less than 0.05 was considered to indicate a statistically significant difference. Statistical analysis of the data was performed using SPSS 18.0 software (SPSS Inc., Chicago, IL, USA) and graphs were generated using GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA).
There were 149 NSCLC patients and 83 healthy controls (
To identify an internal control that is capable of reliably quantifying the expression of the target miRNAs in plasma, we examined the levels of miR-16 and RNU6B using RT-qPCR in plasma samples of 20 NSCLC patients and 20 healthy controls. To normalize the difference in extraction efficiency and reverse transcription efficiency among the different samples, the plasma levels of miR-16 and RNU6B were compared with spiked-in cel-miR-39. No significant difference was observed in the levels of miR-16 (P=0.158) and RNU6B (P=0.557) between the NSCLC patients and healthy controls (
To screen the potential upregulated miRNAs, we first examined the expression levels of 10 candidate miRNAs (miR-30d, miR-383, miR-20a, miR-145, miR-221, miR-25, miR-223, miR-21, miR-126 and miR-210) based on previous studies (
In order to increase the number of samples for validation, we merged the 40 cases of samples in the screening stage with those in the validation stage, making 129 cases of NSCLC patients and 83 healthy individuals. Following detection by RT-PCT, we observed that the expression of miR-145, miR-20a, miR-21 and miR-223 in the plasma of NSCLC patients was significantly enhanced compared with that of the healthy controls (
To investigate whether the plasma miR-145, miR-20a, miR-21 and miR-223 were of tumor origin, we collected plasma samples from an independent set of 20 early-stage NSCLC patients, and then examined the plasma expression levels of these four miRNAs before and after surgery with RT-qPCR. We observed that the expression of these four miRNAs was significantly decreased in the post-operative patients compared with the pre-operative patients (
Lung cancer is a major global health problem. Due to the high level of incidence and low therapeutic efficacy, it has become the leading cause of malignancy-related mortality in numerous countries (
Accumulating studies suggest that circulating miRNAs may be used as potential molecular biomarkers for several disease conditions, including human malignancies (
In the present study, we observed that miR-145, miR-20a, miR-21 and miR-223 were significantly dysregulated in NSCLC patients compared with healthy controls. The data from our study demonstrated that each single miRNA presents high sensitivity and specificity in the detection process. Despite the different expression levels, all four of these miRNAs were validated to have the potential to discriminate early-stage NSCLC patients from healthy controls. The panel of four candidate miRNAs demonstrated the highest predictive accuracy in NSCLC detection (AUC=0.897). We also analyzed the expression levels of plasma miRNAs before and after surgery, and observed that the levels of the four candidate miRNAs decreased rapidly following surgical removal of the tumors. Collectively, miR-145, miR-20a, miR-21 and miR-223 presented great clinical value in NSCLC preliminary screening, and further studies in a large population are required to validate the feasibility of these miRNAs as novel non-invasive biomarkers.
Upregulation of miR-21 has been observed in numerous human cancers (
In our study, we also noted that the expression levels of these four miRNAs were significantly different before and 7–10 days after the surgery in early-stage NSCLC patients. However, it is not known what causes this change, and additional studies are required to clarify this.
In this study, we have demonstrated that these four miRNAs in plasma had dysregulated expression in NSCLC, suggesting that they may serve as biomarkers in precise clinical diagnosis of early-stage NSCLC. However, certain limitations in our tests need to be addressed. In the training set, there were only 10 miRNAs included in our study. Further studies are required to expand the investigation number of miRNAs. Secondly, the changes in the miRNA expression level before and after surgery need to be verified using a larger sample. The selection of reference gene is a crucial step for accurate quantification by RT-PCR. However, there is still no well-recognized reference gene for miRNA quantification in plasma. In this study, we selected miR-16 and RNU6B as candidate reference genes and observed no significant difference between them in early-stage NSCLC patients and healthy individuals. However, RNU6B was not stable at room temperature; therefore, we selected miR-16 as the internal reference, and this was also supported by previous studies (
In summary, miR-145, miR-20a, miR-21 and miR-223 appear to be novel biomarkers for early detection of early-stage NSCLC. However, other miRNAs that could function as biomarkers for the early diagnosis of NSCLC may also exist in plasma, therefore further studies are required to screen more suitable miRNAs, and thus improve the diagnostic ability for early-stage NSCLC patients.
Expression levels of miR-16 and RNU6B.
Stability of miR-16 and RNU6B at room temperature.
Large-scale validation of (A) miR-145, (B) miR-20a, (C) miR-21 and (D) miR-223 in plasma samples. Expression levels of the miRNAs (Log10 scale for y-axis) are normalized to miR-16. The line represents the median value. The Mann-Whitney U test was used to determine statistical significance.
Receiver operating characteristic curve analysis of miR-145, miR-20a, miR-21 and miR-223.
Combination receiver operating characteristic curve analysis of miR-145 + miR-20a + miR-21 + miR-223.
Changes in miRNA expression levels: (A) miR-145, (B) miR-20a, (C) miR-21 and (D) miR-223, before and 7–10 days after surgery. Expression levels of the miRNAs (Log10 scale for y-axis) are normalized to miR-16.
miRNA-specific primers.
Primer | Sequences (5′-3′) |
---|---|
Cel-miR-39 | TCACCGGGTGTAAATCAG |
miR-30d | CGCTGTAAACATCCCCGAC |
miR-383 | CGCAGATCAGAAGGTGATT |
miR-16 | GTAGCAGCACGTAAATATTGG |
miR-20a | CGCTAAAGTGCTTATAGTGC |
miR-145 | TGAACTTCGCAACTACCGTTTG |
miR-21 | CGCTAGCTTATCAGACTGA |
miR-221 | CGAGCTACATTGTCTGCTGGGT |
miR-126 | CGCTCGTACCGTGAGTAAT |
miR-223 | GCGGGTGTCAGTTTGTCAAATA |
miR-25 | CATTGCACTTGTCTCGGTCTG |
miR-210 | CGCAGCCCCTGCCCACCGC |
RNU6B | ACGCAAATTCGTGAAGCGTT |
Clinical characteristics of NSCLC patients and healthy controls (cases, %).
Training set | Validation set | ||||||
---|---|---|---|---|---|---|---|
Category | Control (n=20) | NSCLC (n=20) | P | Control (n=63) | NSCLC (n=109) | P | Pre- and post-surgery (n=20) |
Gender | 1 | 0.525 | |||||
Male | 12 (60) | 12 (60) | 36 (57.1) | 69 (63.3) | 13 (65) | ||
Female | 8 (40) | 8 (40) | 27 (42.9) | 40 (36.7) | 7 (45) | ||
Age (year) | 1 | 0.539 | |||||
<60 | 9 (45) | 9 (45) | 31 (49.2) | 47 (43.1) | 8 (40) | ||
>60 | 11 (55) | 11 (55) | 32 (40.8) | 62 (56.9) | 12 (60) | ||
Mean age (year) | 61.7+8.8 | 61.0+8.1 | 0.749 | 59.7+8.0 | 59.3+9.0 | 0.783 | 61.4+8.3 |
Smoking status |
0.747 | 0.064 | |||||
Yes | 11 (55) | 13 (65) | 27 (42.9) | 64 (58.7) | 13 (65) | ||
No | 9 (45) | 7 (35) | 36 (57.1) | 45 (41.3) | 7 (45) | ||
TNM stage | |||||||
I | 7 (35) | 48 (44.0) | 6 (30) | ||||
II | 13 (65) | 61 (56.0) | 14 (70) | ||||
Pathological type | |||||||
Adenocarcinoma | 9 (45) | 49 (45.0) | 11 (55) | ||||
Squamous cell carcinoma | 11 (55) | 42 (38.5) | 9 (45) | ||||
Other | 18 (16.5) |
NSCLC, non-small cell lung cancer; P, P-value; TNM, tumor-node-metastasis.
Individuals with smoking index more than 400 are classed as smokers.
Expression levels of 10 plasma miRNAs between 20 NSCLC patients and 20 healthy controls (mean ± SD).
miRNAs | Expression | NSCLC/healthy (fold) | P-value |
---|---|---|---|
miR-145 | ↑ | 21.67+0.89 | 2.04×10−4 |
miR-20a | ↑ | 13.39+1.02 | 9.22×10−5 |
miR-21 | ↑ | 6.15+0.49 | 3.72×10−4 |
miR-223 | ↑ | 2.64+0.39 | 1.48×10−3 |
miR-221 | ↑ | 1.37+0.31 | 0.0612 |
miR-25 | ↑ | 1.23+0.28 | 0.7510 |
miR-30d | ↑ | 1.13+0.29 | 0.3326 |
miR-126 | ↓ | 0.93+0.27 | 0.3942 |
miR-210 | ↓ | 0.62+0.16 | 0.1195 |
miR-383 | / | / | / |
NSCLC, non-small cell lung cancer.