The CRC surgical samples were obtained from part of surgical patients in the Department of Surgery at Peking University First Hospital between August 2011 and December 2012. These were confirmed to be colorectal adenocarcinoma histologically by experienced pathologists. Clinicopathologic staging was determined according to the CRC Guideline of the National Comprehensive Cancer Network (2). Written informed consents were obtained from these patients.

The cell lines DLD1 and LoVo were purchased from the American Type Culture Collection. DLD1 and LoVo were cultured in DMEM and F-12K (both Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) culture media, respectively, at 37°C with 5% CO_2. The media were supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/ml of penicillin, and 100 µg/ml of streptomycin (both Keygen Biotech, Nanjing, China).

The plasmid expressing short hairpin RNA (shRNA) specifically targeting the lncTCF7 (shRNA-lncTCF7) and its scrambled RNA (shRNA-nc) control were constructed by GenePharma Co. (Shanghai, China). The shRNA sequence is 5′-CTTTGGATAAGATCTACGTTT-3′. The plasmid over-expressing lncTCF7 (oe-lncTCF7) and its empty vector (oe-Vec) were obtained from GenePharma Co. Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) was used for the transfection. Cell clones stably expressing the shRNA and oe-lncTCF7 were selected with G418.

Total RNA was extracted from the surgical samples and cultured cells using TRIzol reagent (Takara Bio, Dalian, China). RQ1 RNase-Free DNase (Promega, Madison, WI, USA) was used to remove DNA. RNA reverse transcription to cDNA was performed with RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) and quantitative real-time PCR (qRT-PCR) analysis was performed with SYBR-Green PCR Master Mix (Life) according to the manufacturer's instructions. The results were normalized to the expression of 18S and β-actin. The primers used for qRT-PCR are listed below: lncTCF7 Forward, AGGAGTCCTTGGACCTGAGC and Reverse, AGTGGCTGGCATATAACC-AACA; 18S Forward, GTAACCCGTTGAACCCCATT and Reverse, CCATCCAATCG-GTAGTAGCG; β-actin Forward, CATGTACGTTGCTATCCAGGC and Reverse, CTCC-TTAATGTCACGCACGAT. The ΔCq value was used to represent the expression level of lncRNA in quantitative qRT-PCR. For each amplicon designed, the ΔCq value was normalized using the equation: ΔCq=Cq (target)-Cq (18S/β-actin).

Lysate was extracted from surgical samples or cultured cells by a lysis buffer, and the protein content was assayed by a protein assay (BCA) kit (Thermo Fisher Scientific, Inc.). Protein was fractionated in 10% SDS-PAGE and transferred onto a PVDF membrane (Roche, Mannheim, Germany). Rabbit monoclonal antibodies against E-cadherin, N-cadherin, Vimentin, Slug, c-Myc, Cyclin D1 (Cell Signaling Technology, Inc., Danvers, MA, USA), MMP7 (Abcam, Cambridge, UK) and TCF7 (Abgent Inc., San Diego, CA, USA) were used as the primary antibodies. The antibody against GAPDH (Cell Signaling Technology, Inc.) was used for loading control. Secondary antibody was then added and proteins of interest were visualized by using Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, Inc.).

The effect of lncTCF7 on proliferation of CRC cell lines was measured with Cell Counting kit-8 (CCK-8) (Dojindo). After transfection of shRNA-lncTCF7, shRNA-nc, oe-lncTCF7, or oe-Vec for 48 h, DLD1 and LoVo cells were re-suspended, seeded at 2×10³/100 µl/well in a 96-well plate, and incubated for 24 or 48 h. CCK-8 reagent was added to each well. The plate was incubated for another 2 h at 37°C, and the absorbance at 450 nm was measured.

The migration ability of CRC cells was assayed by a Transwell plate with a filter of 8 µm pores (BD Biosciences, San Diego, CA, USA). A total of 5×10⁵ cells in serum-free medium were added into the upper insert. A total of 600 µl of medium containing 20% FBS was added into the lower compartment. After incubation for 48 h, the cells on the upper surface of the filter were wiped, and the cells adherent on the undersurface of the filter were fixed in methanol, stained with crystal violet and counted with a microscope. Three visual fields were selected randomly for cell counting. An invasion assay was performed in a similar manner except that the top chamber was pre-coated with 50 µl Matrigel (BD Biosciences).

A fragment of 550 bp lncTCF7 cDNA was amplified from the lncTCF7 plasmid by using a high fidelity DNA polymerase (Takara) as the DNA template. From this template, a fluorescein labeled DNA as the lncTCF7 FISH probe was made with fluorescein-12-dUTP (Roche) and Klenow DNA polymerase following the manufacturer's protocol. CRC tissue with its adjacent normal tissue embedded in OCT (Sakura Finetek, Inc., Torrance, CA, USA) was cut to sections of 4 µm thickness. The slide was soaked in proteinase K for 5 min and washed in 2× SSC twice. A FISH hybridization solution (Beijing Dingguo Changsheng Biotechnology Co., Ltd., Beijing, China) containing 30 ng/µl lncTCF7 FISH probe DNA was applied to the slide which was subsequently incubated at 37°C for 16 h. The slide was then washed in 0.4× SSC/0.001% NP-40 at 560C for 5 min followed by a second wash in 2× SSC/0.0001% NP-40 for another 2 min. The slide was covered with a drop of mounting medium containing DAPI, and observed under a fluorescence microscope.

Male BALB/c nude mice of 4–5 weeks age were purchased from Beijing Vital River Co. (Beijing, China) and maintained in the Experimental Animal Center of Peking University First Hospital. DLD1 cells (1×10⁷ cells) stably expressing shRNA-lncTCF7, or oe-lncTCF7, or respective control vectors were mixed with 50% Matrigel (BD Biosciences), and were injected subcutaneously into the right flank of a nude mouse (n=6/group). Tumor volume was measured every 2 days and calculated as width² x length/2. After two weeks, the mice were sacrificed, the tumors were removed and weight was measured.

Two-tailed Student's t-test was used for data comparison. χ² test was performed to evaluate the association between lncTCF7 level and clinicopathological parameters. Kaplan-Meier method was used to estimate overall survival of the CRC patients. P<0.05was considered to indicate a statistically significant difference. Each experiment was repeated at least 3 times independently.

lncRNAs have been reported to play a role in tumorigenesis and progression and aberrant expression of lncRNAs has been associated with worse cancer prognosis. We found that lncTCF7 was significantly increased in cancer tissue in comparison with peri-tumor control.

In 58 CRC cases, 52 cases showed a higher lncTCF7 expression levels in tumor than in peri-tumor mucosa and the median ratio increased 3-fold (Fig. 1A). Using RNA-FISH, we examined the location of lncTCF7 in two pairs of specimens as shown in Fig. 1B, more abundant lncTCF7 RNA was seen in cancer tissue compared with peri-tumor mucosa and it was specifically localized in the nuclei of CRC specimens. In Fig. 1C, increased TCF7 protein expression was also noted by western blot in ten pairs of specimens.

The DLD1 and LoVo cells transfected with shRNA-lncTCF7 had reduced expression of lncTCF7 compared to cells transfected with shRNA-nc as measured by qRT-PCR (Fig. 2A). As shown in Fig. 2B, suppression of lncTCF7 led to a mild decrease in cell growth. Cell migration was assessed by Transwell assay (Fig. 2C). In both DLD-1 and Lovo cell lines, there was a 30–40% decrease in migrated cell numbers in shRNA-lncTCF7 group compared to that in control. In addition, reduced expression of lncTCF7 also inhibited invasion by 25~30% (Fig. 2D).

We also measured cell proliferation and migration after overexpressing lncTCF7 in DLD-1 and Lovo lines (Fig. 3A). As shown in Fig. 3B and C, increased lncTCF7 stimulated CRC cell proliferation and migration significantly. Fig. 3D showed that overexpression of lncTCF7 increased cell invasion rate by 80~100%.

Taken together, these in vitro experiments support the hypothesis that lncTCF7 promotes tumor cell migration and invasion.

Next we detected how lncTCF7 influences tumorigenesis in vivo. 1×10⁷ cells were inoculated into nude mice and tumor growth was monitored for 14 days (Fig. 4A). At the sixth day, a palpable tumor could be recognized. As shown in Fig. 4, reduced expression of lncTCF7 in the shRNA-lncTCF7 group led to significantly smaller tumor volume and weight (Fig. 4A, C, left), and a slower tumor growth (Fig. 4B, left). On the other hand, overexpression of lncTCF7 with oe-lncTCF7 resulted in faster growth (Fig. 4B, right), and bigger tumor size (Fig 4C). These data indicate that lncTCF7 promotes CRC tumorigenesis in vivo.

Given the finding that lncTCF7 promotes CRC cell migration and invasion, we attempted to investigate the underlying molecular mechanisms. Epithelial-mesenchymal transition, EMT, is pivotal in cancer metastasis and invasion (4) and the Wnt signaling pathway is one of the key pathways in regulating EMT (5). Thus, we set out to examine if lncTCF7 affects the Wnt signal pathway.

First, the epithelial and mesenchymal markers were assayed by western blot analysis. Fig. 5A shows that lncTCF7 inhibited the expression of E-cadherin, an epithelial marker, but enhanced the expression of N-cadherin, Vimentin and slug, three classic mesenchymal markers, in DLD1 and LoVo cells.

Next, we assessed the state of the Wnt pathway upon lncTCF7 manipulation by measuring several downstream effects. As shown in Fig. 5B, reduced expression of lncTCF7 resulted in reduced expression of c-Myc, Cyclin D1 and MMP7 while overexpressing lncTCF7 demonstrated opposite effects.

To test the value of lncTCF7 as a prognostic biomarker, we studied the association between lncTCF7 expression and clinical profiles of CRC patients. Demographic and clinical data were reviewed (Table I). A total of 58 cases were categorized according to LncRNA expression level. Group of lncTCF7 was divided according to median expression fold compared to its peri-tumor. As shown in Table I, there were significant differences in tumor size, lymph node metastasis, and TNM stage between two groups.

Furthermore, Kaplan-Meier survival analysis revealed worse prognosis in the high lncTCF7 group. The overall 3-year survival rate was about 68% in the high group, and 89% in the low group (Fig 6). The median follow-up time is 47 months. Log rank test confirmed that the difference is statistically significant (P=0.0441 with a hazard ratio of 3.513, 95% confidence interval 1.032 to 9.996).