Tangeretin, a natural polymethoxyflavone present in the peel of citrus fruits is known to exhibit anticancer properties against a variety of carcinomas. Previous experimental evidence suggests that lifestyle and dietary habits affect the risk of prostate cancer to a certain extent. As the effect of tangeretin on prostate cancer is unexplored, the present study investigated the effect of tangeretin on androgen-insensitive PC-3 cells and androgen-sensitive LNCaP cells. Tangeretin reduced the cell viability of PC-3 cells in a dose- and time-dependent manner, with the half-maximal inhibitory concentration (IC50) observed at 75 µM dose following 72 h of incubation, while in LNCaP cells, the IC50 was identified to be ~65 µM. Expression levels of the mesenchymal proteins including vimentin, cluster of differentiation 44 and Neural cadherin in PC-3 cells were reduced by tangeretin treatment, whereas those of the epithelial proteins, including Epithelial cadherin and cytokeratin-19 were upregulated. Treatment of PC-3 cells also resulted in the downregulation of the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathway. Therefore, it may be concluded that tangeretin induces reprogramming of epithelial-mesenchymal transition in PC-3 cells by targeting the PI3K/Akt/mTOR signaling pathway.
Prostate cancer is the second most prevalent cancer in the United States of America, and also the second leading cause of mortality in the western world (
The majority of prostate cancer-associated mortalities are due to the acquisition of the metastatic phenotype of the disease, and the epithelial to mesenchymal transition (EMT) is known to serve a pivotal role in tumor metastasis (
Flavonoids are naturally occurring polyphenols, which constitute a major part of the human diet, and are abundantly present in fruits, grains, vegetables and traditional medicinal herbs (
Tangeretin was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). Dulbecco's modified Eagle's medium (DMEM; supplemented with 1 mM L-glutamine), fetal bovine serum, penicillin-streptomycin and 0.25% Trypsin-EDTA were purchased from Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Primary antibodies including rabbit polyclonal anti-B-cell lymphoma 2 (Bcl-2)-associated X protein (Bax) antibody (cat. no., sc-493), and mouse monoclonal anti- Bcl-2 antibody (cat. no., sc-7382), were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA), and rabbit polyclonal anti-cleaved caspase-3 (cat. no., 9661), rabbit monoclonal cleaved anti-caspase-9 (cat. no., 7237), rabbit monoclonal anti-phosphorylated (p)-protein kinase B (pAkt; cat. no., 4060), rabbit monoclonal anti-Akt (cat. no., 4691), rabbit monoclonal anti-p-mammalian target of rapamycin (pmTOR; cat. no., 5536) and rabbit monoclonal anti-mTOR (cat. no., 2983) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). The single-stranded DNA (ssDNA) Apoptosis ELISA Kit (cat. no., APT225) was purchased from EMD Millipore (Billerica, MA, USA).
The prostate cancer PC-3 and LNCaP cell lines were purchased from American Type Culture Collection (Manassas, VA, USA) and routinely maintained in DMEM supplemented with 10% FBS and 100 U/ml penicillin and 100 µg/ml streptomycin, at 37°C in a humidified chamber.
Human PBMC were isolated from the whole blood of adult healthy donors using the density gradient Ficoll-Hypaque (Histopaque 1077, Sigma Aldrich; Merck KGaA) method. Whole blood collected from the donor was carefully mixed with equal volume of Ficoll-Hypaque and centrifuged at 400 × g for 30 min at room temperature. The PBMC were collected from the plasma/Ficoll-Hypaque interphase, washed in PBS (twice for 30 min) and resuspended in RPMI-1640 complete medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. The present study was approved by the Ethical Committee Board of Linyi People's Hospital (Linyi, China). Donors provided written informed consent to the inclusion of their samples in the present study.
Cultured prostate cancer cells (1×104 cells/ml) were treated with different concentrations of tangeretin (0, 25, 50 µM) for 24, 48 and 72 h. Following treatment, MTT solution (0.5 mg/ml; Thermo Fisher Scientific, Inc.) was added to each well followed by 100 µl of isopropanol (10%)/PBS and the resultant purple-blue formazan complex was measured using a Varian Cary 50MPR microplate reader (Akribis Scientific, Knutsford, UK) at an absorbance 570 nm, as described previously (
Induction of apoptosis by tangeretin in prostate cancer cells was determined by ELISA-based apoptosis detection kit (EMD Millipore) following previously described protocol (
Cultured prostate cancer cells (1×104 cells/ml) were treated with tangeretin (0, 50 and 75 µM) for 72 h and following treatment, cells were fixed in 4% paraformaldehyde and stained with 20 µM Hoechst 33258 for 20 min. Cells were then observed and images (NIS imaging system software 4.5 ver) were captured at a magnification of ×100 using an inverted fluorescence microscope.
The anchorage-dependent growth properties of PC-3 cells were evaluated by their ability to form viable colonies. Cultured PC-3 cells (1×104 cells/ml) were treated with tangeretin (0, 50 and 75 µM) for 72 h. Following treatment, single cell suspensions were prepared from the control and treated groups, and cells were finally seeded at a density of ~500 cells/ml. Cells were cultured for 7 days and the viable colonies were stained for 10 h with 0.5 mg/ml crystal violet at 37°C. Colony forming efficiency (CFE) was determined by re-suspending the crystal violet stained cells in 10% acetic acid solution and measuring the absorbance at 600 nm.
Anchorage-independent growth was assessed by seeding the control and tangeretin-treated cells on soft agar (0.4% top layer, 0.8% bottom layer). Cultured PC-3 cells (1×104 cells/ml) were treated with tangeretin (0, 50 and 75 µM) for 72 h. Following treatment, single cell suspension was prepared from the control and treated groups, and finally seeded on soft agar-coated 96-well plates, following previously described protocol (
The migratory activities of PC-3 cells were determined by a wound-healing assay. Cultured PC-3 cells were grown to ~80% confluency, and a wound was created with a sterile plastic pipette tip. Cells were then allowed to migrate for 48 h in the absence and presence of 75 µM tangeretin, and images were captured using a phase contrast microscope (magnification, ×100).
The invasive properties of PC-3 cells were determined by a Boyden chamber assay, using Matrigel®-coated invasion chambers (BD Biosciences, Franklin Lakes, NJ, USA) (
Total RNA from the control and tangeretin-treated PC-3 cells were isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturers' protocol. Reverse transcription of the extracted RNA to corresponding complementary DNA was performed using a commercially available kit (Takara Bio, Inc., Otsu, Japan). RT-qPCR was performed with QuantiTech SYBR® Green PCR Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol, as previously described (
Cultured PC-3 cells were treated with tangeretin (0, 50 and 75 µM) for 72 h, washed with PBS and incubated with RIPA lysis buffer (Sigma-Aldrich; Merck KGaA) for 2 h at 37°C. The resultant cell lysates were centrifuged at 3,000 × g for 10 min at 37°C and total cellular protein was calculated using a BCA Protein Assay Reagent kit (BioVision, Inc., Milpitas, CA, USA). Equal quantities of protein (50 µg/lane) was separated by 10% SDS-PAGE, and then electrotransferred onto a nitrocellulose membrane by a semi-dry blotting system (GE Healthcare, Little Chalfont, UK). The membrane was blocked with Tris-buffered saline (TBS) containing Tween-20 and 5% skimmed milk and probed with the following primary antibodies: Rabbit polyclonal anti-B-cell lymphoma 2 (Bcl-2)-associated X protein (Bax) (cat. no., sc493; 1:1,200) antibody, mouse monoclonal anti- Bcl-2 antibody (cat. no., sc-7382; 1:1,000) (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and rabbit polyclonal anti-cleaved caspase-3, rabbit monoclonal cleaved anti-caspase-9, rabbit monoclonal anti-phosphorylated (p)-protein kinase B (pAkt) (cat. no., 4060; 1:1,000), rabbit monoclonal anti-Akt (cat. no., 4691; 1:800), rabbit monoclonal anti-p-mammalian target of rapamycin (pmTOR) (cat. no., 5536; 1:1,000) and rabbit monoclonal anti-mTOR (cat. no., 2983; 1:1,200) as well as mouse monoclonal anti-rat β-actin antibody (cat. no., 5723; 1:1,500) (Cell Signaling Technology, Inc., Danvers, MA, USA) at 4°C for 10 h. Subsequently, samples were incubated with goat anti-rabbit (cat. no., sc-2979; dilution, 1:10,000) and anti-mouse (cat. no., sc-358914; dilution, 1:10,000) secondary antibodies conjugated to horseradish peroxidase-conjugated (Santa Cruz Biotechnology, Inc.) secondary antibody in TBS at room temperature for 1 h and washed with TBS. The bound antibodies were visualized using an Enhanced Chemiluminescence system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and densitometry analysis was then performed (ChemiDoc-17001401; Image Lab-5.2.1; Bio-Rad Laboratories, Inc.).
All data are expressed as the mean ± standard deviation. Statistically significant differences between groups were determined by using the paired Student's two-tailed t-test. P<0.05 was considered to indicate a statistically significant difference.
The effect of tangeretin treatment on the viability of androgen-insensitive PC-3 and androgen-sensitive LNCaP cells was evaluated by MTT assay. Tangeretin induces a significant reduction of cell viability in PC-3 cells in a time- and dose-dependent manner (
To evaluate the toxicity of tangeretin on normal cells, the viability of human PBMC in the presence of tangeretin was determined. Following treatment for 72 h, it was observed that tangeretin exhibited negligible cytotoxicity on PBMC compared with the cancer cells, and in the presence of 100 µM tangeretin, the cell viability was decreased by only 20% (
To determine the mode of cell death induced by tangeretin, the apoptosis assay was performed with tangeretin-treated PC-3 and LNCaP cells. The induction of apoptosis was determined using the ssDNA Apoptosis ELISA kit. Tangeretin treatment resulted in a dose-dependent induction of apoptosis in PC-3 cells (
Subsequent to confirmation of the involvement of apoptosis in tangeretin-mediated cell death, the status of several anti- and pro-apoptotic markers was also investigated. The pro-apoptotic markers such as Bax, caspase-9 and caspase-3 were upregulated, and the anti-apoptotic Bcl-2 was downregulated in tangeretin-treated PC-3 cells (
The colony-forming ability of PC-3 cells was markedly inhibited by tangeretin in a dose-dependent manner. PC-3 cells were treated with different doses of tangeretin (0–75 µM) for 72 h and the residual cells were collected. Equal numbers of cells from control and treatment groups were then seeded to observe the colony formation and anchorage independent growth. The CFE was determined by crystal violet staining of the viable colonies. It was observed that tangeretin significantly inhibited the colony-forming ability of PC-3 cells in a dose-dependent manner (P<0.05;
The ability of the cancer cells to form colonies on soft agar due to their ability of anchorage-independent growth, is considered to be the hallmark of tumorigenesis. The untreated PC-3 cells, when seeded in the soft agar, formed several viable colonies. However, in the tangeretin-treated groups, the number of viable colonies was revealed to be significantly reduced (P<0.05;
The migratory activities of PC-3 cells were identified to be markedly inhibited by tangeretin as determined by the wound-healing assay (
It was observed that subsequent to treatment with tangeretin, the morphology of PC-3 cells was significantly altered, and the treated cells exhibited an increased epithelial-like morphology compared with the mesenchymal morphology of the control cells (
Akt-signaling serves an important role in the maintenance of the tumor phenotype in prostate cancer (
A number of epidemiological studies have indicated that, instead of a particular specific carcinogen, several factors associated with lifestyle, dietary, and environmental factors may serve as the etiology of prostate cancer (
The present study observed that treatment of the prostate cancer PC-3 and LNCaP cell lines with tangeretin resulted in dose-and time-dependent loss of cell viability, with negligible cytotoxicity in PBMC. In addition, it was also observed that tangeretin induces caspase-3-mediated apoptosis in prostate cancer cells. The ability to form colonies by PC-3 cells under anchorage-dependent and -independent conditions was also inhibited by tangeretin in a dose-dependent manner. As hypothesized, it was also observed that tangeretin treatment also inhibited the motility of PC-3 cells, as revealed by the migration and invasion assays.
EMT is an important pathophysiological process which serves an important role in the metastasis of prostate cancer to distant organs, and also in the maintenance of stemness (
Akt, a serine/threonine protein kinase, is a key regulator of apoptosis, regulating the downstream signaling pathway of apoptosis, whereas mTOR acts as a downstream effector for Akt and regulates key processes such as cell growth and proliferation and cell cycle progression (
Therefore, the present study presented a novel therapeutic approach to prostate cancer. The dietary flavonoid tangeretin was identified to be effective against PC-3 cells. Reprogramming of the EMT process, via downregulation of PI3K/Akt/mTOR pathway serves as the primary mechanism of tangeretin-induced cytotoxicity in PC-3 cells.
Reduction of cell viability by tangeretin. (A) Chemical structure of tangeretin. (B) Cultured PC-3 cells were grown in the presence or absence of different concentrations of tangeretin (0–100 µM) for 24, 48 and 72 h, and cellular viability was determined by MTT assay. (C) Cultured LNCaP cells were grown in the presence or absence of different concentrations of tangeretin (0–100 µM) for 24, 48 and 72 h, and cellular viability was determined by MTT assay. (D) Effect of tangeretin on PBMC viability. The results are expressed as mean ± standard deviation of 3 independent experiments. *P<0.05 vs. tangeretin-treated cells (50 and 100 µM). PBMC, peripheral blood mononuclear cells.
Induction of apoptosis and modulation of pro-and anti-apoptotic markers by tangeretin. (A) PC-3 cells were treated with tangeretin (0–75 µM) for 72 h, and apoptosis was determined using an apoptosis detection kit. (B) Induction of apoptosis in LNCaP cells by tangeretin. (C) Hoechst 33258 staining of the apoptotic nuclei of PC-3 and LNCaP cells treated with tangeretin (0–75 µM). (D) Western blot analysis demonstrating the expression of Bax, Bcl-2, cleaved caspase-3 and caspase-9 in control and tangeretin-treated PC-3 cells. Results are expressed as mean ± standard deviation of three independent experiments. *P<0.05 vs. tangeretin-treated cells (25, 50 and 100 µM). Tan, tangeretin; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; Cl, cleaved.
Inhibition of colony formation of PC-3 cells by tangeretin. (A) Colony formation of PC-3 cells in the absence and presence of tangeretin. (B) Proportion of CFE of control and tangeretin-treated PC-3 cells. (C) Anchorage-independent colony formation of control and tangeretin-treated PC-3 cells. (D) Average number of colonies formed by control and tangeretin-treated PC-3 cells under anchorage-independent growth conditions. Results are expressed as mean ± standard deviation of 3 independent experiments. *P<0.05 vs. tangeretin-treated cells (50 and 100 µM). CFE, Colony forming efficiency.
Inhibition
Reversal of EMT by tangeretin. (A) Phase contrast image of control and tangeretin-treated PC-3 cells. (B) Bar graph representing the expression levels of EMT-associated genes as obtained by quantitative reverse transcription polymerase chain reaction analysis. (C) Western blotting of N-cadherin and E-cadherin in control and tangeretin-treated PC-3 cells. (D) E-cadherin/N-cadherin ratio in control and tangeretin-treated PC-3 cells. Results are expressed as mean ± standard deviation of 3 independent experiments. *P<0.05 vs. tangeretin-treated cells (100 µM). EMT, epithelial-mesenchymal transition; N, neural; E, epithelial; cad, cadherin; Vim, vimentin; CD44, cluster of differentiation 44.
Effect of tangeretin on Akt/mTOR pathway. Cultured PC-3 cells were treated with different doses of tangeretin (0–75 µM) for 72 h. Western blot analyses for p-Akt (Ser 473), Akt, p-mTOR (Ser 2448) and mTOR were performed. (A) Western blotting for p-Akt (Ser 473) and Akt. (B) p-Akt/Akt ratio for control and tangeretin-treated PC-3 cells. (C) Western blotting for p-mTOR (Ser 2448) and mTOR. (D) p-mTOR/mTOR ratio for control and tangeretin-treated PC-3 cells. Results are expressed as mean ± standard deviation of 3 independent experiments. *P<0.05 vs. tangeretin-treated cells (50 and 100 µM). Akt, protein kinase B; mTOR, mammalian target of rapamycin; p, phosphorylated.
List of genes, with their primer sequences, used for quantitative reverse transcription polymerase chain reaction.
Gene | Primer sequence (5′-3′) |
---|---|
Vimentin | |
Forward | AACTTAGGGGCGCTCTTGTC |
Reverse | CCTGCTGTCCCGCCG |
CD44 | |
Forward | CCCAGATGGAGAAAGCTCTG |
Reverse | GTTGTTTGCTGCACAGATGG |
N-cadherin | |
Forward | CCTTTCACTGCGGATACGTG |
Reverse | GATCCAGGGGCTTTGTCACC |
E-cadherin | |
Forward | TGAGTGTCCCCCGGTATCTT |
Reverse | GAATCATAAGGCGGGGCTGT |
Cytokeratin | |
Forward | CGGGGCCTCACTCTGCGATATAA |
Reverse | GCGAGTGGTGAAGCTCATGC |
E, epithelial; N, neural; CD, cluster of differentiation.