Contributed equally
Accumulating studies have demonstrated microRNAs (miRNAs/miRs) have an important role in multiple processes of human malignant tumor development and progression. Decreased expression of miR-125a-5p has been observed in several types of cancer, including gastric cancer (GC). However, the mechanism and exact function of miR-125a-5p in GC have not been largely elucidated. In the present study, reverse transcription-quantitative polymerase chain reaction indicated that the expression of miR-125a-5p was downregulated in GC tissues and cell lines compared with matched normal tissues (P<0.01) and normal gastric mucosa cell lines (P<0.01), respectively. Moreover, clinical pathological characteristics and Kaplan-Meier analysis indicated that a low expression of miR-125a-5p was not only associated with lymph metastasis, peritoneal dissemination and advanced tumor-node metastasis stage but also affected the prognosis of GC patients. Compared with miR-control-transfected GC cells, markedly decreased migration and invasion was observed in GC cells that overexpress miR-125a-5p. By contrast, increased metastasis and invasion were observed in miR-125a-5p-knocked down cells compared with the control. Furthermore, luciferase reporter assays indicated that breast cancer metastasis suppressor 1 (BRMS1) was a direct target of miR-125a-5p. Notably, a positive correlation between the levels of BRMS1 and miR-125a-5p in GC tissues was observed, and BRMS1 expression was indicated to be regulated by miR-125a-5p in GC cells. In conclusion, miR-125a-5p may act as a tumor suppressor by targeting the metastasis-inhibitory gene, BRMS1. The data suggesting that BRMS1 is a potential target gene of miR-125a-5p, may provide novel insight into miRNA regulation of human gene expression, and a useful target for gene therapy of GC.
Gastric cancer (GC) is a frequently diagnosed cancer among males and females worldwide, and an estimated 951,600 new stomach cancer cases and 723,100 mortalities occurred in 2012 (
MicroRNAs (miRNAs/miRs) are endogenous small single-stranded RNA molecules and consist of 18–23 nucleotides. It has been found that miRNAs are able to participate in the regulation of cell proliferation, differentiation, metabolism and apoptosis (
Breast-cancer metastasis suppressor 1 (BRMS1) is a gene, which inhibits metastasis. First identified in 2000 (
In the present study, a low expression of miR-125a-5p was frequently observed in GC tissues and cell lines, and a low miR-125a-5p expression was associated the prognosis of patients with GC. It has also been demonstrated that miR-125a-5p expression may affect the invasion and migration of GC cells
The present study was approved by the Ethics Board of the Institute of the First Affiliated Hospital of Nanchang University (Nanchang, China). The ethics board also supervised and examined the whole process of the present study. All participants agreed to join the present study and provided written informed consent.
Cancer tissue samples and matched normal samples (distance from tumor, ≥5 cm) were obtained from 82 GC patients (43 males and 39 females; mean age, 58.3 years, age range, 33–85) who underwent surgical resection from February 2010 to November 2012 at the Department of General Surgery, First Affiliated Hospital of Nanchang University (Nanchang, China). The samples were immediately stored in liquid nitrogen following removal from patients and detailed clinical data were collected. The histological grade was assessed according to the tumor-node-metastasis (TNM) system (
Human GC cell lines (SGC7901, HGC27 and BGC823) were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The human gastric mucosa GES1 and HFE145 cell lines were stored in the Central Laboratory of the Center for Experimental Medicine, the First Affiliated Hospital of Nanchang University, Nanchang, China), which were obtained from American Type Culture Collection (Manassas, MA, USA). All cell lines were cultured in Dulbecco's modified Eagle's medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin at 37°C with 5% CO2. The cells in the exponential phrase were used for experiments.
Total RNA was extracted from cells or tissues using a standard Trizol protocol (Invitrogen; Thermo Fisher Scientific, Inc.). To detect the expression of mRNAs, reverse transcription was conducted using the GoScriptTM Reverse Transcription system (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol. To detect the level of miRNA expression, reverse transcription was conducted using the EnergicScript® cDNA Synthesis kit (ShineGene Molecular Biotech, Inc., Shanghai, China). Subsequently, the RT-qPCR detection system FTC-2000 (Funglyn Biotech Inc., Toronto, Canada) was used to measure the levels of mRNA expression and miRNA with Shine-SYBR® Real Time qPCR MasterMix kit (ShineGene Molecular Biotech, Inc.). The expression of mRNA and miRNA was normalized to endogenous controls β-actin and U6 small nuclear RNA. Relative fold changes were calculated by the 2−ΔCq method or the 2−ΔΔCq method (
The human miR-125a-5p plasmids, miR-control plasmids, anti-miR-125a-5p and anti-miR-control were designed and generated by Shanghai GenePharma Co., Ltd., Shanghai, China (Shanghai, China). The siRNA small-interfering (si)RNA (#S1 sequence, 5′-GGAAUAAGUACGGAAUGUGA-3′) that targets the BRMS1 gene was synthesized by Guangzhou RiboBio Co., Ltd., (Guangzhou, China) as previously described (
The invasive and migratory capacity of the cells was estimated using Transwell chambers (diameter, 6.5 mm, membrane pore size, 8 µm; Corning Incorporated, Corning, NY, USA). To conduct invasion assays, the membranes were coated with 1 mg/ml Matrigel (BD Biosciences, Franklin Lakes, NJ USA), Matrigel was not used for migration assays. The cells (migration assay, 5×104 cells; invasion assay, 1×105 cells) were suspended in 200 µl serum-free medium, and the cells were added to the upper chamber. Then, 600 µl 20% FBS-DMEM was added to the lower chamber. Following incubation at 37°C for 24 h, the non-migrating or non-invading cells were removed with cotton swabs. Finally, invaded cells on the lower side of the filter were fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) at 37°C for 30 min. The cells were counted in five different fields with a microscope (Olympus Corporation, Tokyo, Japan).
MiR-125a-5p target genes were identified using four web-based bioinformatics algorithms:
The 5′-UTR of the BRMS1 segment was amplified by PCR and inserted into the pHY-LV-Report 3.1 vector (
Total protein was extracted from gastric tissues and cells by Total Protein Extraction kit (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China) according to the manufacturer's protocol and using the BAC kit (Tiangen Biotech Co., Ltd., Beijing, China) to detect the concentration of the proteins. The proteins were separated by 12% SDS-PAGE and transferred onto polyvinyl fluoride (PVDF) membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were blocked with 5% non-fat dried milk for 1 h at room temperature. Then, the membranes were incubated with the primary monoclonal antibody against BRMS1 (1:500; Sigma-Aldrich; Merck KGaA; catalog no. WH0025855M1, Merck KGaA) or β-actin (1:1,000; Cell Signaling Technology, Inc., catalog no. 8H10D10) overnight at 4°C. After washing the membranes with TBST (TBS with 0.1% Tween-20) three times, the membranes were incubated for 2 h at room temperature, with horseradish peroxidase-conjugated secondary antibody (goat anti-mouse IgG; Abcam, Cambridge, UK; catalog no. ab97023) and the ECL Western Blotting Analysis system (GE Healthcare, Chicago, IL, USA) was used to detect the levels of expression of the target proteins. Band intensities were quantified using Image-Pro Plus software (version, 6.0; Media Cybernetics, Inc., Rockville, MD, USA).
All experiments in the present study were repeated at least three times. The data are presented as the mean ± standard deviation and P<0.05 was considered to indicate a statistically significant difference. SPSS (version, 19.0; IBM Corp., Armonk, NY, USA) software was used for statistical analysis. Differences between the groups were estimated using the χ2, Student's t-test and one-way analysis of variance with a Student-Newman-Keuls post-hoc test. Survival was evaluated using the Kaplan-Meier method, and the correlation between miR-125a-5p and BRMS1 protein expression level was evaluated using Pearson's correlation.
To determine the level of miR-125a-5p expression in GC, three malignant human GC cell lines (SGC7901, HGC27 and BGC823) and two normal gastric mucosa cell lines (GES1 and HFE145), as well as 82 pairs of cancer tissues and matched normal tissues from patients with GC were used to perform RT-qPCR analysis. It was observed that the levels of miR-125a-5p were significantly lower in the GC cell lines compared with the expression in normal gastric mucosa cell lines (
To investigate the associations between miR-125a-5p expression and clinical pathological characteristics, the data of 82 patients was collected from the Pathology Department of the First Affiliated Hospital of Nanchang University, and the detailed information is listed in
Previously, the association between miR-125a-5p and GC metastasis was observed (as aforementioned) and the expression of miR-125a-5p was downregulated in patients with gastric cancer, it was hypothesized that a lower miR-125a-5p expression in GC tissues was involved in invasion and metastasis of GC cells. In order to investigate the hypothesis, SGC7901 and HGC27 cells were successfully transfected with miR-125a-5p to generate an miR-125a-5p-overexpression model. The miR-control was also transfected. Invasion and migration analyses were then performed. The results showed that the migratory (P<0.05;
It has been verified that miRNAs generally regulate the expression of target genes to regulate cellular processes associated with cancer, including metastasis (
To determine the association between miR-125a-5p expression and BRMS1 protein levels, the expression of BRMS1 in 82 GC patient tissues was also detected. The mean levels of BRMS1 protein were also decreased in GC samples compared with the expression in normal gastric samples (
To further verify the effects of miR-125a-5p on the regulation of BRMS1 expression, RT-qPCR and western blotting were performed to detect the relative mRNA and protein expression level in various GC cell lines (SGC7901, HGC27, BGC823). The results indicated that overexpression of miR-125a-5p (
Considering the aforementioned results, whether BRMS1 is a functional target of endogenous miR-125a-5p, which affects GC cells migration and invasion, was investigated. BGC823 cells were transfected separately with si-BRMS1 and anti-miR-125a-5p, and BRMS1 expression was analyzed by RT-qPCR and western blotting. The transfection efficiency of si-BRMS1 and anti-miR-125a-5p was detected (
Migration and invasion assays revealed that knockdown of BRMS1 mRNA was able to significantly increase the migration and invasion of the BGC823 cells, and similar results were observed when there is a low expression of miR-125a-5p in GC cells (
In the present study, it was observed that miR-125a-5p is able to act as a tumor suppressor in GC. It was also revealed that downregulation of miR-125a-5p was a risk factor for lymph node and peritoneal metastasis in patients with GC.
In GC cells, upregulated miR-125a-5p expression was able to inhibit cell invasion and migration. Furthermore, to the best of our knowledge, BRMS1 was identified as a potential novel target of miR-125a-5p, and BRMS1 was associated with peritoneal metastasis in GC.
It has been hypothesized that miRNAs may function as tumor suppressors or tumor promoters, and thus perform critical roles in tumor development and progression (
In addition, miR-125a-5p expression was negatively associated with lymph node metastasis, peritoneal dissemination and advanced TNM stage.
As part of the present study on how the loss of miR-125a-5p affects GC metastasis, it was confirmed that BRMS1 was a critical downstream target of miR-125a-5p. BRMS1 is a tumor suppressor (
To further study the regulatory mechanisms between miR-125a-5p and BRMS1, target prediction programs were used to predict BRMS1 mRNA binding site that binds with miR-125a-5p. It was identified that the 5′-UTR of BRMS1 contained a conserved putative target site for miR-125a-5p.
In previous studies, miRNAs have been frequently reported to negatively regulate gene expression and pair with the 3′-UTR of specific target mRNAs (
In summary, miR-125a-5p was identified as a potential tumor suppressor in GC. Additionally, miR-125a-5p inhibits the metastatic characteristics of GC cells
The authors thank the Departments of General Surgery and Pathology at the First Affiliated Hospital of Nanchang University for providing tissue samples and related clinical data.
The present study was supported by the National Science Foundation of China (grant nos. 81460373 and 81360362) and the ‘Talent 555 Project’ of Jiangxi, China.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
ZGJ conceived the study; ZGJ, ZRL, YC, SXT and YT designed the experiments; SXT, GYZ, YL, DJL, SX and JBX identified, designed, or performed the methods; SXT, GYZ, DJL, ZBL, WYZ and PTG performed the experiments; SXT, GYZ and YC analyzed the data; and YC, SXT and ZGJ wrote the paper.
The present study was approved by the Ethics Board of the Institute of the First Affiliated Hospital of Nanchang University (Nanchang, China). The ethics board also supervised and examined the whole process of the present study. All participants agreed to join the present study and provided written informed consent.
All participants provided written informed consent for publication of the present study.
The authors declare that they have no competing interests.
miR-125a-5p was downregulated in GC and associated with the capacity to metastasize. (A) The expression of miR-125a-5p in three GC cell lines (BGC823, SGC7901 and HGC27) and two normal gastric cell lines (GES1 and HFE145) was analyzed by RT-qPCR. Values are shown as the mean ± standard deviation (n=3). *P<0.05, **P<0.01 compared with GES1 and HFE145. (B) RT-qPCR results showed that miR-125a-5p expression was decreased in primary cancer tissues compared with matched normal tissues (P<0.001). (C) Expression of miR-125a-5p in primary GC tissues with (n=14) and without peritoneal metastasis (n=68) (P=0.0421). (D) Kaplan-Meier curves indicate that the poor prognosis of GC patients was positively associated with miR-125a-5p expression level (P=0.0092). The expression of miR-125a-5p was normalized to the expression of U6 small nuclear RNA. Each experiment was repeated three times. GC, gastric cancer; miR, microRNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
miR-125a-5p inhibits the migration and invasion of GC cells
Confirmation of predicted binding sites between miR-125a-5p and BRMS1. (A) The bioinformatics websites (
Expression of BRMS1 in GC tissues and cell lines, and positive correlation of BRMS1 expression with miR-125a-5p expression level. (A) Representative western blot result of GC tissues (n=6) and matched normal tissues (n=6). (B) Expression of BRMS1 in 82 GC tissues and matched normal tissues were detected by western blotting as shown by scatter plot (P<0.01). BRMS1 expression was normalized to β-actin expression. (C) Linear correlation analysis between the levels of BRMS1 protein and miR-125a-5p in GC tissues using Spearman's correlation analysis (n=82, r=0.5676; P<0.01). (D) The levels of BRMS1 protein in three gastric cancer cell lines (BGC823, SGC7901 and HGC27) and two normal gastric cell lines (GES1 and HFE145). β-actin was used as an internal loading control. BRMS1, breast cancer metastasis suppressor 1; GC, gastric cancer; miR, microRNA; N, normal tissues; T, gastric cancer tumor tissues.
miR-125a-5p regulates the expression of BRMS1 in GC cell lines. (A) Compared with the expression of miR-125a-5p in miR-control-transfected controls, miR-125a-5p expression in miR-125a-5p plasmid-transfected cells was upregulated. By contrast, following the transfection of anti-miR-125a-5p, the miR-125a-5p expression in BGC823 cells was significantly suppressed. *P<0.05, **P<0.01. The expression of BRMS1 mRNA and protein in (B) SGC7901 and (C) HGC27 cells following the transfection of miR-NC or miR-125a-5p. *P<0.05 vs. Mock or miR-control groups. (D) Following transfection of BGC823 cells with anti-miR-125a-5p, the expression of BRMS1 mRNA and protein was significantly decreased compared with the expression in anti-miR-NC or mock groups. *P<0.05. For reverse transcription-quantitative polymerase chain reaction assays, β-actin was used as an internal control for expression of BRMS1, and the values indicate the mean ± standard deviation (n=3). For western blotting, β-actin served as an internal control. BRMS1, breast cancer metastasis suppressor 1; miR, microRNA; NC, negative control; si, small-interfering.
Involvement of BRMS1 in miR-125a-5p-induced suppression of migration and invasion of GC cells. (A) BRMS1 mRNA levels in BGC823 cells analyzed by reverse transcription-quantitative polymerase chain reaction following transfection with si-BRMS1, anti-miR-125a-5p, BRMS1 and anti-miR-125a-5p. The error bars represent standard deviation values obtained from three independent experiments. *P<0.05, **P<0.01. The value was normalized by β-actin. (B) The levels of BRMS1 protein in BGC823 cells that were transfected with si-BRMS1, anti-miR-125a-5p, and a combination of BRMS1 and anti-miR-125a-5p as detected by western blotting. β-actin served as an internal control. (C) Migration and (D) invasion assays in BGC823 cells transfected with different plasmids. Values for cell numbers represent the mean ± standard deviation (n=3). *P<0.05, **P<0.01. BRMS1, breast cancer metastasis suppressor 1; GC, gastric cancer; miR, microRNA; si-small-interfering.
All primers and sequences used in the present study.
Name | Sequence (5′-3′) |
---|---|
qPCR | |
BRMS1 Forward | CAGCCTCCAAGCAAAGACAC |
BRMS1 Reverse | GCGGCGTCGCTCATAGTC |
miR-125a-5p Forward | GCTCCCTGAGACCCT |
miR-125a-5p Reverse | GAGCAGGCTGGAGAA |
β-actin Forward | TGACGTGGACATCCGCAAAG |
β-actin Reverse | CTGGAAGGTGGACAGCGAGG |
U6 snRNA Forward | CTCGCTTCGGCAGCACA |
U6 snRNA Reverse | AACGCTTCACGAATTTGCGT |
Luciferase assays | |
BRMS15′UTR(WT) Forward | CCGCTCGAGAAGCACCGATAGGCTCTGCCTC |
BRMS1 5′UTR (WT) Reverse | CGGGATCCCTGGACTCGCGGGGACTGG |
BRMS1 5′UTR(MU) Forward | CCGCTCGAGAAGCACCGATAGGCTCTGCCTC |
BRMS1 5′UTR (WT) Reverse | CGGGATCCCTGGCCTCGCGGGGACTGGAGCCTCTGGCCTCACGACGGAGATTGGGACTCAGCTGCCC |
miRNAs and siRNAs | |
BRMS1 Forward | CCGCTCGAGGCCACCATGCCTGTCCAGCCTCCAAG |
BRMS1 Reverse | CGCGGGCCCTCACTTGTCGTCATCGTCCTGTAGTCAGGTCCATCCGATTTTCTCTTCT |
Si-BRMS1 Forward | GATCCGGAATAAGTACGAATGTGATTCAAGAGATCACATTCGTACTTATTCTTTTTTG |
Si-BRMS1 Reverse | AATTCAAAAAAGGAATAAGTACGAATGTGATCTCTTGAATCACATTCGTACTTATTCCG |
miR-125a-5p sense | GAGCUCUCCCUGAGACCCUUUAACCUGUGAAAGCUU |
miR-125a-5p antisense | AAGCUUUCACAGGUUAAAGGGUCUCAGGGAGAGCUC |
miR-125a-5p control sense | UUCUCCGAACGUGUCACGUTT |
miR-125a-5p control antisense | ACGUGACACGUUCGGAGAATT |
qPCR, quantitative polymerase chain reaction; WT, wild type; MT, mutant; BRMS1, breast cancer metastasis suppressor 1; miRNA/miR, microRNA; siRNA, small interfering RNA; UTR, untranslated region.
Clinicopathological characteristics of patients with gastric cancer and miR-125a-5p expression in tumor tissues.
miR-125a-5p expression (n, %) | |||||
---|---|---|---|---|---|
Characteristics | n | Low | High | X2 | P-value |
Age, years | |||||
<65 | 58 | 37 (72.5) | 21 (67.7) | 0.215 | 0.643 |
≥65 | 24 | 14 (27.5) | 10 (32.3) | ||
Sex | |||||
Male | 43 | 24 (47.1) | 19 (61.3) | 1.566 | 0.211 |
Female | 39 | 27 (52.9) | 12 (38.7) | ||
Tumor size, cm | |||||
>3.5 | 27 | 19 (32.8) | 8 (33.3) | 0.003 | 0.960 |
≤3.5 | 55 | 39 (67.2) | 16 (66.7) | ||
Tumor location | |||||
Proximal | 17 | 12 (19.4) | 5 (25.0) | ||
Middle | 18 | 14 (22.6) | 4 (20.0) | 0.303 | 0.859 |
Distal | 47 | 36 (58.0) | 11 (55.0) | ||
Differentiation | |||||
Well | 15 | 14 (25.0) | 1 (6.2) | ||
Moderate | 26 | 22 (39.4) | 4 (25.0) | 3.256 | 0.196 |
Poor | 41 | 30 (53.6) | 11 (68.8) | ||
Lymph node metastasis | |||||
Absent | 23 | 13 (21.7) | 10 (45.5) | 4.514 | 0.034 |
Present | 59 | 47 (78.3) | 12 (54.5) | ||
Peritoneal metastasis | |||||
Absent | 68 | 43 (76.8) | 25 (96.2) | 4.705 | 0.030 |
Present | 14 | 13 (23.2) | 1 (3.8) | ||
TNM stage | |||||
I–II | 40 | 21 (39.6) | 19 (65.5) | 5.030 | 0.025 |
III–IV | 42 | 32 (60.4) | 10 (34.5) |
P<0.05 was considered to be statistically significant. Statistical significance was assessed by chi-square test. miR, microRNA; TNM, tumor-node-metastasis.