Contributed equally
Solamargine, an active ingredient of
Cholangiocarcinoma is a common primary biliary malignancy that originates from bile duct epithelial cells and has presented difficulties in diagnosis and treatment (
Solamargine is an alkaloid that is primarily derived from the
Apoptosis serves an important function in tumor formation and metastasis and is typically repressed in the tumor microenvironment (
Solamargine (
High-performance liquid chromatography (HPLC). 0.02 mg/ml solamargine is preparaed in 80% ethanol and detected by HPLC Agilent 1100 series (Agilent Technologies, Inc., Santa Clara, CA, USA). Chromatographic condition are displayed below. Chromatographic column: SinoChrom ODS-BP (C18), 5 µm, 250×4.6 mm (catalog no. 31110006, Dalian Elite Analytical Instruments Co., Ltd, Liaoning, China). Column temperature: 30°C. Mobile phrase consists of acetonitrile and 0.1% ammonium hydroxide. The content of acetonitrile in gradient mobile phrase varies as below: From 25 to 45% in 0–20 min; from 45 to 75% in 20–30 min, flow rate is 1 ml/min, detected at wavelength 203 nm, sample loading volumn is 5 µl.
Human cholangiocarcinoma QBC939 cells were cultured in RPMI-1640 medium supplemented with 10% (v/v) FBS, 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were maintained at 37°C in a humidified environment containing 5% CO2. For all the experiments, cells were serum-starved and treated with solamargine for the specified times.
QBC939 cells, in the period of logarithmic phase, were seeded in 96-well plate at a density of 1×104 cells/well in 100 µl RPMI-1640 medium, in triplicate, and cultured at 37°C overnight in an atmosphere containing 5% CO2. Cells were allowed to culture to 70% confluence/well and were treated with solamargine at the indicated concentration (0, 2, 4, 6, 8, 10, 12 and 14 µM) for 24 h at 37°C. The morphology of QBC939 cells was observed by using inverted microscopy (magnification, ×200) (Olympus Corporation, Tokyo, Japan). Subsequently, 10 µl MTT (5 mg/ml) was added to cells. After 4 h incubation at 37°C, the cell medium was removed completely and 100 µl DMSO was added in cells to resolve the blue formazan crystals of live cells. The optical density of cells/well was measured at absorbance wavelength 570 nm using the Multiskan Spectrum Microplate Reader (Tecan Group, Ltd., Mannedorf, Switzerland). Finally, cell viability in the different treated groups (0, 2, 4, 6, 8, 10, 12 and 14 µM solamargine) was calculated as a proportion, using the formula: Cell viability (%)=(OD570 nm-OD630 nm)treated/(OD570 nm-OD630 nm)untreatedx100%.
QBC939 cells, in the period of logarithmic phase, were seeded in 6-well plates (3×105 cells/well, in 2 ml RPMI-1640 medium) and cultured overnight at 37°C in an atmosphere containing 5% CO2. Cells were allowed to culture to 70% confluence/well and were treated with solamargine at the indicated concentration (0, 2, 4, 6, 8 and 10 µM) for 24 h at 37°C. Cells were digested using 0.25% Trypsin-EDTA at 37°C, washed with PBS and resuspended in 100 µl 1X Binding Buffer (included in the Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit). Cells in each group (0, 2, 4, 6, 8 and 10 µM) were stained with 5 µl propidium iodide (PI) and 5 µl Annexin V-FITC, according to the Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit (BD Biosciences, Franklin Lakes, NJ, USA) protocol and incubated for 15 min at room temperature in the dark. An aliquot of 400 µl 1X Binding Buffer was added and the apoptosis of QBC939 cells was detected by Guava easyCyte 6–2L flow cytometer (Merck KGaA, Darmstadt, Germany) and analyzed by the GuavaSoft software (version 2.7; Merck KGaA, Darmstadt, Germany).
QBC939 cells in the mid-log phase were seeded in 12-well plates (2×105 cells/well in 1 ml RPMI 1640 medium) and cultured overnight at 37°C. Cells were treated with solamargine at 2, 4, 6, 8 and 10 µM for 24 h at 37°C. The treated cells were washed with PBS two times and digested with 0.25% Trypsin-EDTA. Carbonyl cyanide 3-chlorophenylhydrazone (from the mitochondrial membrane potential assay kit) was added into the positive control well and incubated at 37°C for 20 min. A total of 1 ml JC-1 staining buffer was added to the wells and incubated for 20 min at 37°C in the dark. The supernatant was removed at 600 × g for 3 min at room temperature. Cells were washed with JC-1 washing buffer (1X) two times and then suspended in washing buffer. Flow cytometry was conducted to detect JC-1 fluorescence and analyze the change in mitochondrial membrane potential (MMP) in QBC939 cells.
QBC939 cells in the mid-log phase were seeded in 6-well plates (3×105 cells/well in 2 ml RPMI 1640 medium) and cultured overnight at 37°C. Cells were allowed to culture to 70% confluence and were treated with 0, 2, 4, 6, 8 and 10 µM solamargine for 24 h at 37°C. The treated cells were washed with PBS twice and total RNA in cells was extracted using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). According to the manufacturer's protocol of the first cDNA synthesis kit for RT-qPCR, mRNA was reverse transcribed to cDNA by using the reaction system (Reaction Mix 4 µl, Maxima Enzyme Mix 2 µl, Template RNA 500 ng, and add nuclease-free Water to 20 µl) and the reaction procedure (25°C for 10 min, 50°C for 15 min, 85°C for 5 min). The reaction system included (Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Inc.) 10 µl, forward primer 0.3 µM, reverse primer 0.3 µM, Template DNA 300 ng, and nuclease-free water until a final volume of 25 µl), the thermocycling conditions were 95°C for 10 min, 1 cycle; 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec, 40 cycles of qPCR, the genes (Bax, Bcl-2, Bcl-xL, XIAP) mRNA relative expression were detected by fluorescence quantitative PCR equipment (Applied Biosystems, Thermo Fisher Scientific, Inc.) and analyzed by the 2−∆∆Cq method. GAPDH mRNA expression was used as the control. Primers used in the experiments were synthesized by GenScript Biotech (Nanjing, China) and are listed in
QBC939 cells in the period of logarithmic phase were seeded in 6-well plates (3×105 cells/well in 2 ml RPMI 1640 medium) and cultured overnight at 37°C in an atmosphere containing 5% CO2. Cells were allowed to culture to 70% confluence/well and were treated with solamargine at the indicated concentration (0, 2, 4, 6, 8 and 10 µM) for 24 h at 37°C. Cells were washed with ice cold PBS three times and digested using RIPA lysis buffer with protease phosphatase inhibitor cocktail (Thermo Scientific, Inc., Waltham, MA, USA) on ice for 5 min. Cell lysates were selected and centrifuged (12,000 × g, 10 min, 4°C) to remove the cell debris. Total protein concentration was determined using the BCA Protein Assay kit (Beyotime Institute of Biotechnology) and detected using the Multiskan Spectrum Microplate Reader. Cell lysates are mixed with 2X Sample Buffer and heated in water at 100°C for 5 min. Prepared protein (~30 µg per lane) was separated using SDS-PAGE (12% gels) and transferred onto polyvinylidene difluoride membranes (Merck KGaA). After the proteins were transferred to the PVDF membrane, protein was blocked using Tris-Buffered Saline (TBS) containing 5% non-fat milk for 1 h at room temperature and incubated with primary antibody (Bax, Bcl-2, caspase3, caspase7, XIAP, PARP and β-actin, all antibodies come from Cell Signaling Technology Incorporation, antibodies were diluted by 1:1,000) overnight at 4°C. The PVDF membrane was washed with TBS-0.1% Tween 20 and incubated with the Dylight 800-labeled goat anti-rabbit immunoglobulin G (H+L) fluorescence antibody (dilution, 1:10,000; catalog no. 072-07-15-06, KPL, Inc., Gaithersburg, MD, USA) for 1 h at room temperature. The blot membrane was exposed and scanned by the Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE, USA).
Data are expressed as the mean ± standard deviation of 3 independent experiments. The difference between different groups was analyzed using a one-way analysis of variance (with Tukey's post-hoc test) or a Student's t-test. P<0.05 was considered to indicate a statistically significant difference. The data were analyzed using SPSS software (version 16.0; SPSS, Inc., Chicago, IL, USA) and graphs were plotted using GraphPad Prism software (version 5; GraphPad Software, Inc., La Jolla, CA, USA).
To determine the precision of experiment and the quality of solamargine, HPLC was used to determine the purity of solamargine. The results revealed that the purity of solamargine was >98% (
The effect of solamargine on QBC939 cells was observed using light microscopy (magnification, ×200) at first. As the concentration of solamargine increased (0, 2, 4, 6, 8 and 10 µM), the morphology of cholangiocarcinoma cells changed markedly at 24 h. Solamargine may cause shrinkage, irregularity and inhibit the viability of cells (
To validate whether solamargine inhibits the viability of QBC939 cells by inducing apoptosis, the apoptosis of QBC939 cells, after 24 h treatment with different concentrations of solamargine (0, 2, 4, 6, 8 and 10 µM), was determined using flow cytometry. After QBC939 cells were digested and harvested, cells were stained with Annexin V-FITC and PI. Cells positive for Annexin V-FITC only represented early apoptotic cells, whereas cells positive for Annexin V-FITC and PI represented late apoptotic cells. Flow cytometric analysis revealed that solamargine induced apoptosis of cholangiocarcinoma QBC939 cells significantly in a dose-dependent manner. Solamargine significantly induced apoptosis at >6 µM and could primarily induced early apoptosis (
The present study identified that solamargine may induce the pro-apoptosis of human cholangiocarcinoma cells significantly. The alteration in mitochondrial membrane potential may lead to early apoptosis (
Based on the above results, the molecular mechanism of apoptosis effect of solamargine on human cholangiocarcinoma QBC939 cells was subsequently investigated. The present study assessed the expression of apoptosis-associated proteins in QBC939 cells, after 24 h treatment with different concentrations of solamargine (0, 2, 4, 6, 8 and 10 µM), using RT-qPCR and western blot analysis. The total RNA of QBC939 cells was extracted using TRIzol reagent and the mRNA was transcribed into cDNA. The relative expression of Bax, Bcl-2, Bcl-extra-large (Bcl-xL) and XIAP mRNA was determined using RT-qPCR (using GAPDH as the reference gene). The results revealed that solamargine significantly inhibited Bcl-2 and XIAP mRNA levels but significantly increased the mRNA level of Bax (
Cholangiocarcinoma is a type of aggressive and refractory malignancy, and characterized by late diagnosis and poor outcomes; therefore, identifying novel therapeutic drugs is required (
The results of the present study indicated that solamargine may induce apoptosis significantly in human cholangiocarcinoma QBC939 cells via the MMP pathway. Solamargine is the one member of natural compounds (luteolin, matrine, berberine and so on) against human cholangiocarcinoma (
Not applicable.
The present study was supported by the Research Innovation Program for Academic Degree Postgraduate of Jiangsu Province General University (grant no. 2014965) and the Key Project supported by the Medical Science and Technology Development Foundation, Nanjing Department of Health (grant no. YKK14176).
All data generated or analyzed during this study are included in this published article.
Cell culture and apoptosis detection were conducted by XZ and ZY. Western blotting and RT-qPCR were performed by TX and ZA. HPLC was analyzed by MH. Experimental data were analyzed by WC and XW. FZ and ZY were the major contributors to study design and wrote the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Solamargine. (A) Structural formula of solamargine (molecular formula, C45H73NO15; molecular weight, 868.06; CAS no. 14197-65-0). (B) Solamargine purity, determined using high-performance liquid chromatography.
Effect of solamargine on cell viability and morphology of cholangiocarcinoma QBC939 cells. (A) The morphology of QBC939 cells, following treatment with different concentrations of solamargine for 24 h, observed using light microscopy (magnification, ×200). (B) QBC939 cells were treated with different concentrations of solamargine for 24 h and viability was determined using an MTT assay. *P<0.05, **P<0.01 vs. control.
Cholangiocarcinoma QBC939 cells apoptosis induced by solamargine. (A) Apoptosis of QBC939 cells induced by treatment with different concentrations of solamargine for 24 h, stained using Annexin V-FITC/PI and determined using flow cytometry. (B) Statistical data of QBC939 cell apoptosis. Apoptosis rate contains the early apoptosis rate and late apoptosis rate. *P<0.05, **P<0.01. FITC, fluorescein isothiocyanate; PI, propidium iodide.
Alteration in MMP induced by solamargine in QBC939 cells. (A) Alteration in MMP of QBC939 cells induced by treatment with different concentrations of solamargine for 24 h, stained with JC-1 buffer and determined using flow cytometry. Cells treated with 10 µM CCCP were used as a positive control. (B) Statistical data of change rate of mitochondrial membrane potential in QBC939 cells. *P<0.05. CCCP, carbonyl cyanide 3-chlorophenylhydrazone; MMP, mitochondrial membrane potential.
Effect of solamargine on the expression and activation of apoptosis-associated proteins. (A) The expression of Bax increased with solamargine treatment; whereas the expression of Bcl-2, Bcl-xL and XIAP decreased with solamargine treatment. Determined using quantitative polymerase chain reaction, with GAPDH used as the internal control. (B) Western blot analysis indicated that solamargine treatment increased expression of Bax, caspase-3, cleaved caspase-3, caspase-7 and cleaved PARP but decreased the expression of Bcl-2, XIAP and PARP. β-actin was used as the internal control. *P<0.05, **P<0.01 vs. control. Bcl-2, B-cell lymphoma-2; Bcl-xL, Bcl-extra-large; Bax, Bcl-2-associated X protein; XIAP, X-linked inhibitor of apoptosis protein; PARP, poly ADP ribose polymerase.
Primers used for quantitative polymerase chain reaction.
Sequence (5′-3′) | ||
---|---|---|
Name | Forward | Reverse |
GAPDH | GCAAATTCCATGGCACCGTC | GACTCCACGACGTACTCAGC |
Bax | GAACCATCATGGGCTGGACA | GCGTCCCAAAGTAGGAGAGG |
Bcl-2 | GAACTGGGGGAGGATTGTGG | CCGTACAGTTCCACAAAGGC |
XIAP | TGGCAGATTATGAAGCACGGA | GGTCTTCACTGGGCTTCCAA |
Bcl-xL | ACTCTTCCGGGATGGGGTAA | ACAAAAGTATCCCAGCCGCC |
Bcl-2, B-cell lymphoma-2; xL, extra large; Bax, Bcl-2-associated X protein; XIAP, X-linked inhibitor of apoptosis protein.