Patient-matched PCa and adjacent non-cancerous prostate tissues (15 pairs) were obtained from patients (mean age, 68.7±13.7 years; age range 45–83 years) who had undergone radical prostatectomy at the Department of Oncology, 202 Hospital of Chinese People's Liberation Army (Shenyang, China) between January 2015 to Feb 2016. The adjacent non-cancerous prostate tissues from the patients with PCa were used as controls. PCa tissue specimens (n=15) were identified as prostatic adenocarcinoma. None of the cases had received any previous cancer-associated treatment or had a history of any other type of cancer. Tumors were staged according to the 2010 revised TNM system (15).

The whole blood samples (5 ml) from the aforementioned patients with PCa and healthy donors (69.2±14.3) were collected in tubes containing EDTA between January 2015 and February 2016 at the Department of Oncology, 202 Hospital of Chinese People's Liberation Army. Total RNA was extracted using RNAzol LS (Vigorous Biotechnology Beijing Co., Ltd., Beijing, China, http://www.vigorousbiol.com/), according to the manufacturer's protocols. The concentration and purity of the RNA samples were determined by OD260/OD280.

The clinicopathological characteristics are presented in Table I. All the samples were snap-frozen in liquid nitrogen immediately and were stored at −80°C following surgery until RNA extraction. The study protocols were approved by the Local Ethics Committees of 202 Hospital of the Chinese People's Liberation Army and written informed consent was obtained from all patients and healthy donors prior to tissue or blood collection.

The PCa PC-3 cell line was purchased from the Chinese Academy of Sciences Cell Bank and cells were cultured in RPMI-1640/F12 medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.), streptomycin (100 mg/ml) and penicillin (100 U/ml) at 37°C in a humidified atmosphere containing 5% CO₂.

AAV-NNMT or AAV-NC was constructed by Shanghai GeneChem Co., Ltd. (Shanghai, China). The PCa PC-3 cells were seeded at the density of 10⁶ cells/well. At 70% confluency, AAV-NNMT or AAV-NC was transfected without transfection reagent into PC-3 cells at 30 multiplicity of infection (MOI) for 48 h. Following 48 h transfection, the cells were collected for subsequent experimentation.

siRNA was synthesized based on the human NNMT target sequence (3′-GCTCAAGAGCAGCTACTACAT-5′; Shanghai Genchem Co., Ltd., Shanghai, China). In brief, PC-3 cells were seeded onto a 6-well plate and were transfected with 20 µM siRNA using Lipofectamine^® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols. Following transfection for 24 h, cells were collected for further experiments.

To investigate the effect of NNMT on PC-3 cell viability, PC-3 cells were seeded in 96-well tissue culture plates at a density of 5×10⁴ cells per well in DMEM medium. When the confluence reached 70%, AAV-NNMT was transfected each well at 37°C for 24, 48 and 72 h. When the confluence reached 70%, siRNA targeting NNMT was transfected into each well for 24, 48 and 72 h, respectively. Cell viability was examined with MTT assay kits (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The blue formazan products in the cells were dissolved in 150 µl dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA) and spectrophotometrically measured at a wavelength of 550 nm. All experiments were performed in triplicate.

PC-3 cells were seeded onto a 6-well plate at a density of 5×10⁵ cells/well until 90% confluence. Next, a scratch was produced in each well using 10-µl pipette tips. Following AAV-NNMT or AAV-NC transfection for 48 h at 37°C, the cells were washed with phosphate-buffered saline (PBS) three times and the width of the scratch was measured under an inverted microscope (IX83, Olympus Corporation, Tokyo Japan) (×10 magnification) at different time points following transfection. All the experiments were repeated three times.

Migration and invasion assays were performed using transwell chambers with membrane pore size of 8.0 µm (Corning Incorporated, Corning, NY, USA). Membranes were uncoated for the migration assays and coated with 25 µg Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) for the invasion assays. They were incubated with PBS (migration) or Matrigel during 1 h at 37°C, 5% CO₂ atmosphere. PC-3 cells at log-phase were prepared and fasted for 12 h in serum-free RPMI-1640/F12 as aforementioned. The cells were collected and rinsed with PBS three times. Next, cells were re-suspended at 6×10⁵ cells/ml. Additionally, 0.1 ml cell suspension was added into 24-well Transwell chambers, with the lower chamber containing 0.5 ml RPMI-1640/F12 medium, supplemented with FBS. Following 24 h of incubation, cells were stained with 0.1% crystal violet for 10 min at room temperature and were rinsed with PBS, followed by rinsing with 33% acetic acid. Subsequently, cells were visualized under an inverted microscope (magnification, ×200) to examine the microporous membrane lower cell. Subsequently, 10 randomly selected fields were used to calculate the average.

Total protein was extracted from PC-3 cells or PCa tissues or adjacent non-cancerous prostate tissues using radioimmunoprecipitation assay buffer (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). A BCA protein assay kit (Pierce; Thermo Fisher Scientific, Inc.) was used to determine the protein concentration. A total of 20 µg protein in each lane was separated by 12% SDS-PAGE, prior to being transferred onto a polyvinylidene fluoride membrane. Following blocking with 5% skimmed milk powder for 2 h at room temperature, monoclonal antibodies against NNMT (cat. no., ab58743), SIRT1 (cat. no., ab32441) and GAPDH (cat. no., ab9485) (all dilution, 1:1,000; Abcam, Cambridge, MA, USA) were applied for overnight incubation at 4°C. Non-specific binding was blocked using 8% (w/v) milk in Tris-buffered saline with 1% Tween-20 (TBST; Beijing SolarBio Science & Technology Co., Ltd.) for 2 h at room temperature. Following several washes with TBST, the membranes were incubated with horseradish-peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG, or HRP-conjugated mouse anti-goat IgG (all dilution, 1:5,000; OriGene Technologies, Inc., Beijing, China) for 2 h at room temperature, prior to being washed with TBST. GAPDH was used as the internal control. Signals were detected using enhanced chemiluminescence, according to the manufacturer's protocols (EMD Millipore, Billerica, MA, USA). ImageJ 1.8.0 software (National Institutes of Health, Bethesda, MD, USA) was used for densitometry.

Total RNA was extracted from PC-3 cells or PCa tissues or adjacent non-cancerous prostate tissues using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and was used as the template to synthesize cDNA using a reverse transcription kit (Takara Bio, Inc., Otsu, Japan) according to the instructions. Briefly, 1 µl random primer, 1 µl dNTP mixture and 1 µl RNA were mixed at 65°C for 5 min. Then, 2 µl 5X PrimeScript^™ Buffer, 1 µl PrimeScript RTase, and 4 µl DEPC H2O were added at 30°C for 10 min, 42°C for 20 min, and 95°C for 4 min. Then, the cDNA were collected. RT-qPCR was performed using a fluorescent qPCR kit (Qiagen GmbH, Hilden, Germany) and specific primers. Subsequently, PCR amplification was performed. A total of 1 µg cDNA was used for qPCR using the SYBR^® green Master mix (Roche Diagnostics, Basel, Switzerland) and a Roche Lightcycler 480 (Roche Diagnostics) at 95°C for 10 min followed by 50 cycles of: 95°C for 10 sec; 55°C for 10 sec; 72°C for 5 sec; 99°C for 1 sec; 59°C for 15 sec; 95°C for 1 sec; and cooling to 40°C. All experiments were performed in triplicate against a GAPDH housekeeping gene. Relative expression was normalized against the endogenous control, GAPDH, using the 2^−∆∆Cq method (16). The primers for NNMT, SIRT1, and GAPDH were listed as follows: NNMT-forward (f), 5′-CTGCCTAGACGGTGTGAAGG-3′; NNMT-reverse (r), 5′-CTTGACCGCCTGTCTCAACT-3′; SIRT1-f, 5′-CCTGCCTGGATCCCCTTAGT-3′; SIRT1-r, 5′-GGCCTGTTGCTCTCCTCATT-3′; GAPDH-f, GAGAAGGCTGGGGCTCATTT; GAPDH-r, AGTGATGGCATGGACTGTGG.

10 µg/µl Nicotinamide (72340, Sigma-Aldrich; Merck KGaA) was dissolved in ddH2O. To evaluate the effects of nicotinamide on the expression of SIRT1, nicotinamide was added in the RPMI-1640/F12 culture at the final concentration of 20 ng/µl in the presence or absence of AAV-NNMT.

SPSS 19.0 software (IBM Corp., Armonk, NY, USA) was used to process all of the collected data, and those that fit a normal distribution are presented as the mean ± standard deviation. Multiple-group comparisons were performed using analysis of variance, followed by the least significant difference post hoc test. P<0.05 was considered to indicate a statistically significant difference.

In the present study, the NNMT mRNA level in the peripheral blood of healthy donors was used as a negative control (NC) when comparing with the NNMT mRNA level of NNMT in the peripheral blood of patients with PCa. In order to compare the expression of NNMT in prostate tissues, the PCa tissues and adjacent non-cancerous prostate tissues were collected from patients with PCa. To begin with, the expression of NNMT in the peripheral blood and tissues of patients with PCa was evaluated. As depicted in Fig. 1A, the mRNA level of NNMT was notably elevated in the peripheral blood of patients with PCa, compared with that in the NC samples. The expression of NNMT in the tissues of patients with PCa was also evaluated and the data demonstrated that NNMT expression was notably increased, compared with that in the NC adjacent non-cancerous prostate tissues (Fig. 1B). Furthermore, the protein expression level of NNMT was determined to be increased in the tissues of patients with metastases, compared with that of the patients without metastases (Fig. 1C).

Next, the possible association between NNMT and SIRT expression was evaluated. Overexpression of NNMT significantly increased the mRNA expression of SIRT1 in PC-3 cells (P<0.05; Fig. 2A). Furthermore, western blot analysis indicated that the protein expression of SIRT1 was elevated in the tissues of patients with PCa, compared with that in the tissues of NC subjects (Fig. 2B).

Following this, the effect of NNMT on the malignant phenotype of PC-3 cells was investigated. An MTT assay demonstrated that the overexpression of NNMT increased the cell viability by 34.5, 78.6 and 123.2% at 24 (P<0.05), 48 (P<0.05) and 72 h (P<0.01), respectively (Fig. 3A). By contrast, the knockdown of NNMT notably suppressed PC-3 cell viability by 12.3, 22.1 and 34.5% at 24, 48 (P<0.05) and 72 h (P<0.05), respectively (Fig. 3B). Furthermore, the upregulation of NNMT elevated the cell migration and colony formation capacity (Fig. 3C and D).

Additionally, the underlying mechanism through which NNMT promotes the malignancy of PCa was investigated. Therefore, an SIRT1 inhibitor, nicotinamide, was selected. As depicted in Fig. 4A, treatment with nicotinamide notably suppressed the expression of SIRT1 even in cells transfected with adeno-associated virus (AAV)-NNMT (Fig. 4A). At the same time, treatment with nicotinamide suppressed PC-3 cell migration (Fig. 4B). By contrast, the upregulation of NNMT notably abolished the nicotinamide-reduced cell migration capacity (Fig. 4B). These data indicated that NNMT enhanced PC-3 cell malignancy primarily through the upregulation of NNMT.