The present study was approved by the Ethic Committee of the Third Affiliated Hospital of Soochow University (Changzhou, China). A total of 55 patients with ovarian cancer were included (age range, 45–75 years; median age, 58 years) between January 2015 and January 2016, and their tumor tissues and the adjacent non-cancerous counterparts were frozen in liquid nitrogen once removed from the body (surgical resection) and subjected to subsequent RNA extraction. All patients stated their full intention to participate in the present study, and written consent from each patient was also obtained.

HO-8910, and SK-OV-3 human ovarian cancer cells were purchased from the American Type Tissue Collection (Manassas, VA, USA). All cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplied with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a 5% CO₂ incubator. Specific siRNAs against NNT-AS1 (GCAAGCUGACCCUGAAGUUCA) and siNC (CUACAUCGACAAGGUGCGCGU) were designed and synthesized by Shanghai GenePharma Co., Ltd (Shanghai, China) and the concentration of siRNA used for transfection was 1 µM. Cell transfection was performed using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 72 h, according to the manufacturer's protocol.

Total RNA from clinical tissues and cultured HO-8910 and SK-OV-3 cells were extracted using TRIzol^® reagent (Takara Biotechnology, Co., Ltd., Dalian, China), according to the manufacturers' protocol. The quality and quantity of RNA were determined using a NanoDrop 2000 instrument (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) by measuring the absorbance at 260 and 280 nm. cDNA was reverse-transcribed from 500 ng RNA using Prime Script TM Master Mix (Takara Biotechnology, Co., Ltd.). qPCR was then performed using SYBR Green reagent (Takara Biotechnology, Co., Ltd.), according to the manufacturer's protocol. The thermocycling protocol was as follows: Initial denaturation at 95°C for 5 min, followed by 45 repeats of a three-step cycling program consisting of 10 sec at 95°C (denaturation), 10 sec at 60°C (primer annealing) and 10 sec at 72°C (elongation), and a final extension step for 10 min at 72°C. The results were normalized to the expression of GAPDH (15). The primers used were the following: NNT-AS1, 5′-CTCCGAACCAAAAGGCGAC-3′ (forward) and 5′-CTTTGTTCTGATGGGACCC-3′ (reverse); GAPDH, 5′-CGCTCTCTGCTCCTCCTGTTC-3′ (forward) and 5′-ATCCGTTGACTCCGACCTTCAC-3′ (reverse).

The HO-8910 and SK-OV-3 cells were seeded (1×10⁴ cells) in 6-well plates, pre-treated with siNNT-AS1 for 72 h at 37°C and spread onto 12-well plates (100 cells/well) in triplicate. The plates were incubated at 37°C for 14 days continuously. Subsequently, the colonies were fixed with chilled 100% methanol and stained with crystal violet (1%) for 5 min at room temperature. Colonies that contained >50 cells were considered to be surviving cells under a light microscope (Nikon Corporation, Tokyo, Japan) at magnification, ×200.

Each group of HO-8910 and SK-OV-3 cells was seeded into 6-well plates at a concentration of 3×10⁵ cells/well, and pre-treated with specific siRNA against NNT-AS1 when the cell lines reached 85% confluence. Subsequently, cells were collected following low-speed centrifugation (840 × g for 5 min) at 4°C, and the cell pellets were resuspended in 1 ml PBS, fixed with 75% ice-cold ethanol and stored at −20°C for 2 days. Prior to flow cytometry analysis, cells were lysed with NP-40 buffer (Beyotime Institute of Biotechnology, Haimen, China), centrifuged (840 × g for 5 min at 4°C) and resuspended in propidium iodide (PI; Thermo Fisher Scientific, Inc.) staining buffer containing 50 µl/ml PI and 250 µl/ml RNase A (Beyotime Institute of Biotechnology). Finally, the cell mixture was incubated at 4°C for 30 min in the dark, and analyzed using a fluorescence-activated cell sorting technique on a flow cytometer (Beckman Coulter, Inc., Brea, CA, USA).

Cell migration and invasion assays were performed in 24-well Transwell plates (8 µm pore membrane, Corning, NY, USA). Following transfection with siRNAs, a total of 1×10⁴ cells (HO-8910 and SK-OV-3 cells) were suspended with FBS-free DMEM and loaded into the upper chambers, while the lower chambers were filled with 600 µl DMEM supplemented with 10% FBS. The plates were incubated at 37°C for an additional 24 h. Subsequently, the cells were fixed with chilled 100% methanol for 5 min at room temperature and stained with 0.1% crystal violet for 5 min at room temperature. Cells on the upper surface of the chambers were removed using cotton swabs, and images of those on the lower surface were captured and counted using a light microscope (Nikon Corporation) at magnification ×200 for five random fields. For the invasion assay, the Transwell membranes were pre-incubated with Matrigel^® (Corning Incorporated, Corning, NY, USA) for 6 h at 37°C.

Wound-healing assays were performed in HO-8910 and SK-OV-3 cells by creating identical wounds using 10 µl sterile pipette tips. Briefly, cells were seeded (1×10⁴) into 6-well plates and co-incubated with siNNT-AS1 for 72 h at 37°C. Subsequently, cells were washed with PBS twice and a cross was scraped in the center of each well, prior to washing twice and immediately being placed in fresh FBS-free DMEM. Images of the cells were captured under a light microscope (Nikon Corporation) at magnification, ×200 for each group and accounted for a time-point 0 h. Following 24 h incubation at 37°C, the two cell lines were observed and images were captured. A total of 5 random fields of view were selected, and the effects of NNT-AS1 were analyzed.

Flow cytometry (FACScan; BD Biosciences, Franklin Lakes, NJ, USA) was used to determine the apoptotic rate upon siNNT-AS1 treatment on HO-8910 and SK-OV-3 cells. Briefly, cells (1×10⁴) cultured in 6-well plates were harvested, washed with PBS and collected following low-speed centrifugation (840 g for 5 min at 4°C). Subsequently, cells were resuspended in 100 µl staining buffer with 5 µl Annexin V-allophycocyanin (20 µg/ml) and 5 µl PI (10 mg/l) (BD Pharmingen; BD Biosciences). Cells were then subjected to flow cytometry (excitation, 488 nm; emission, 635 nm) and cells that were Annexin V-positive were considered to be apoptotic. CellQuest software Pro (version 1.0, BD Biosciences) was used to analyze the data, and each experiment was repeated at least three times in triplicate.

The activities of caspase-3 and caspase-9 were determined using a Caspase-3 Activity kit and a Caspase-9 Activity kit (both from Beyotime Institute of Biotechnology), respectively, according to the manufacturer's protocols. In brief, cell lysates from HO-8910 and SK-OV-3 cells were collected using centrifugation at 840 × g for 5 min at 4°C following siRNA treatment. A total of 10 µl proteins from cell lysates from each group were added into 96-well plates and mixed with 80 µl reaction buffer, which contained caspase substrate (2 mM, Beyotime Institute of Biotechnology). Following incubation for 4 h at 37°C, caspase activities were determined using a microplate reader at an absorbance of 405 nm.

All results are presented as the means ± standard deviation. Each experiment was repeated at least three times in triplicate, unless otherwise stated. Paired student's t-test was performed to determine the difference between two groups. One-way analysis of variance followed by Student-Newman-Keuls test was used to compare the differences between multiple groups. P<0.05 was considered to indicate a statistically significant difference, All data were analyzed using SPSS software (version 19.0; IBM Corp., Armonk, NY, USA).

The relative expression of lncRNA NNT-AS1 in samples from 55 patients with ovarian cancer from The First People's Hospital of Changzhou was determined. It was demonstrated that the relative transcript level of NNT-AS1 was significantly decreased in tumor samples compared with adjacent non-tumor samples (Fig. 1A). Subsequently, four ovarian cancer cell lines were selected for RNA quantification of NNT-AS1. As presented in Fig. 1B, the relative expression of NNT-AS1 was significantly decreased in all four ovarian cancer cell lines used, compared with the expression of NNT-AS1 in 293T cells. Notably, HO-8910PM and OVCAR3 cells exhibited the lowest expression levels of NNT-AS1, whereas the RNA levels of HO-8910 and SK-OV-3 cells were slightly increased compared with the other two cell lines. These results indicated that the expression of NNT-AS1 was markedly decreased in human ovarian cancer cells in vivo and in vitro.

The effects of NNT-AS1 in human ovarian cancer were investigated. Specific siRNAs against NNT-AS1 were transfected into HO-8910 and SK-OV-3 cells, as these two cell lines exhibited the highest transcript levels of NNT-AS1 of the four ovarian cancer cell lines used. As presented in Fig. 2A, the expression levels of NNT-AS1 were significantly decreased in HO-8910 and SK-OV-3 cells when the cells were treated with siNNT-AS1 for 72 h. Subsequently, colony formation assays were performed in HO-8910 and SK-OV-3 cells with or without siNNT-AS1 treatment. Following transfection of the HO-8910 cells with siNNT-AS1, >200 colonies were counted, whereas only ~100 colonies were observed in the control cells (Fig. 2B). Furthermore, cell cycle analysis was also performed in the HO-8910 and SK-OV-3 cells. As presented in Fig. 2C and D, the cell cycle distribution of siNNT-AS1 cells was altered so that the highest proportion of cells were in the G₀/G₁ phase, compared with the other cells (control and siNC) in the two cell lines.

Cell migration are thetwo primary manifestations of malignancies in vivo and in vitro (16). Next, the function of NNT-AS1 in cell migration in HO-8910 and SK-OV-3 cells was investigated. As presentedin Fig. 3A and B, cell migratory capacities in the twocell lines were increased when siNNT-AS1 was transfected for 72 h, as was evidentfrom the >400 cells observed to migrate through the membrane in siNNT-AS1-stimulated cells, whereas only ~200 cells were counted on the lower surface of the membrane. Likewise, cell invasion was also upregulated in HO-8910 and SK-OV-3 cells when cells were treated with siNNT-AS1 (Fig. 3C and D).

Wound-healing assays were also performed to assess the effects of NNT-AS1 on cell migration. As presentedin Fig. 4A and B, knockdown of NNT-AS1 in HO-8910 and SK-OV-3 cells led to increased cell migration and wound healing compared with the control cells without transfections. Quantification of the wound-healing assay also indicated that the wound closure in siNNT-AS1-treated cells was almost 2-fold that of the siNC-treated cells (Fig. 4C and D). Together with the results presented in Fig. 3, these results suggested that NNT-AS1 inhibited cell migration in human ovarian cancer cells in vitro.

Subsequently, the function of NNT-AS1 in cell apoptosis was assessed. As presented in Fig. 5A, transfection with NNT-AS1 inhibited cell apoptosis by 7% in HO-8910 cells and by 5% in SK-OV-3 cells. Next, the relative activity of caspase-3 and caspase-9 was determined in the two cell lines. It was demonstrated that the caspase-3 activity was suppressed by >50% in HO-8910 and SK-OV-3 cells following siNNT-AS1 treatment (Fig. 5B). Furthermore, the relative caspase-9 activity was also inhibited by NNT-AS1 knockdown in the two cell lines (Fig. 5C). These data suggested that the downregulation of NNT-AS1 in human ovarian cancer inhibited cell apoptosis in vitro.