A cohort of 118 patients with CRC who underwent surgical resection at Union Hospital of Huazhong University of Science and Technology (Wuhan, China) between March 2010 and March 2011 was enrolled. The classification of the 118 cases was performed according to the American Joint Committee on Cancer 2010 classification system (15–17). The enrolled patients had not received any previous form of preoperative therapy. Tissue samples, surgically resected from these patients, were confirmed by pathological analysis following hematoxylin and eosin staining. Non-carcinoma tissues were obtained 5 cm from the tumor sections. A total of 6 pieces of each specimen were obtained for examination. Of these pieces, 3 were immersed in formalin, and the others were stored in liquid nitrogen immediately until use. The final survival data were collected on March 30, 2016. The present study was approved by the Ethics Committee of Huazhong University of Science and Technology for Clinical Investigation (Wuhan, China). All patients provided written informed consent prior to enrollment.

In order to analysis the relative levels of mRNA expression, total RNA was collected from clinical specimens using the miRNeasy kit (Qiagen, Inc., Valencia, CA, USA) according to manufacturer's protocol. The primers for DCP1a were as follows: Forward, CACCCCGGTGCTAATCACTC and reverse, GCTCAACGGGATTGTGTAGGTT. The primers for GAPDH were as follows: Forward, AGACAGCCGCATCTTCTTGT and reverse, CTTGCCGTGGGTAGAGTCAT. Firstly, strand cDNA was synthesized from 1 µg RNA using cDNA Reverse Transcription kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer's protocol. The cDNA transcripts (20 ng) synthesized in the present study were used as the template for RT-qPCR using the SYBR-Green method (Bioline Reagents, Ltd., London, UK). The iCycleriQ Real-Time Detection system software v2.3 (Bio-Rad Laboratories, Inc.) was used to determine the level of mRNA. The thermocycling conditions were as follows: Initial activation step (95°C for 20 sec) followed by 40 cycles of 95°C for 6 sec and 60°C for 45 sec. The melting curve was obtained by an initial denaturation step (95°C for 20 sec) followed by a gradual heating from 60 to 95°C (ramp of 0.3°C). The data was analyzed by the Cq method and normalized using GAPDH expression in each sample (18). The primers pairs for the DCP1a and GAPDH were purchased from Sino Biological, Inc. (Beijing, China).

Tissue samples for immunohistochemical analysis were selected by a pathologist. Subsequent to being fixed in 4% formalin and embedded in paraffin for 2 h at 67°C, the tissue specimens were cut into consecutive 4-µm thick sections. Following de-paraffinization with xylene (5 min, 3 times) and gradient rehydration (100% anhydrous ethanol, 10 min twice; 95% ethanol, 10 min twice; distilled water, 5 min twice) at room temperature, antigen retrieval steps were performed as follows: i) Citric acid buffer processing, where the slides were soaked in 10 mM of citrate buffer (pH 6.0), maintained at a boiling temperature (95–99°C) for 10 min and then cooled for 30 min at room temperature; ii) EDTA treatment, where the slides were soaked in 1 mM EDTA solution (pH 8.0) and maintained at a boiling temperature (95–99°C) for 15 min; iii) Tris-EDTA (TE) processing, where the slides were soaked in 10 mM TE/1 mM EDTA solution (pH 9.0) and maintained at a boiling temperature (95–99°C) for 18 min, and then cooled for 30 min at room temperature; and iv) Pepsin processing, including digestion for 10 min at 37°C. Then the slides were blocked with goat serum (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C for 10 min and incubated with polyclonal anti-DCP1a antibody (1:100 dilution; cat. no. ab47811; Abcam, Cambridge, MA, USA) at 4°C overnight. Then the slides were incubated with a secondary antibody (1:2,000; cat. no. ab191866; Abcam; anti-rabbit IgG VHH Single Domain antibody; horseradish peroxidase conjugated) at room temperature for 30 min. The slides were incubated in DAB, and stained with hematoxylin following incubation with a horseradish peroxidase-conjugated lectin at room temperature for 30 min. Then, the slides were washed with distilled water, dehydrated (95% ethanol, 10 sec twice; anhydrous ethanol, 10 sec twice; xylene, 10 sec twice) and mounted using neutral balsam. Then, the slides were observed under a light microscope at a magnification of ×100, and 5 fields of view were selected for analysis. The data was observed by eye. The level of DCP1a expression was compared with the non-carcinoma tissues and designated as high expression when it was increased compared with that in the non-carcinoma tissue. The threshold value was dependent on the expression level in normal tissues.

Total protein was extracted from the tissues using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China). Following incubation with the buffer at 0–4°C for 30 min, the cellular debris was removed by centrifugation at 15,000 × g at 4°C for 30 min. Then, the supernatant was collected. A total of 50 µg of each protein sample (the concentrations of the protein samples were obtained using the BCA method (19) and the BCA protein assay kit (Thermo Fisher Scientific, Inc.) was added to 5X loading buffer (Boster Biological Technology, Pleasanton, CA, USA; volume ratio, 4:1), and boiled (95–99°C) for 5 min. Following separation using 10% SDS-PAGE, the proteins were transferred to a polyvinylidene fluoride membrane by standard electroblotting procedures. The membranes were probed with anti-DCP1a antibody (1:100 dilution; cat. no. ab47811; Abcam; rabbit polyclonal for Dcp1a) and anti-GAPDH antibody (1:200 dilution; cat. no. ab181602; Abcam; rabbit polyclonal for GAPDH) at 4°C overnight. Then, the membranes were incubated with a secondary antibody (1:2,000; cat. no. ab191866; Abcam; anti-rabbit IgG VHH Single Domain antibody; horseradish peroxidase conjugated) at room temperature for 1 h. The protein bands were detected by chemiluminescence using an ECL detector (Thermo Fisher Scientific, Inc.).

All the data were analyzed by SPSS software version 20.0 (IBM Corp., Armonk, NY, USA) and all the experiments were repeated three times, and the data are presented as mean ± 95% confidence interval. A Student's t-test was used to analyze the difference in DCP1a mRNA expression between the clinical carcinoma and non-carcinoma tissues. Analysis between DCP1a expression and clinicopathological parameters in colorectal carcinoma was performed using a χ² test. Cox's regression analysis was used to evaluate the clinicopathological characteristics with respect to carcinoma-specific survival. Survival curves were estimated by the Kaplan-Meier method and differences in survival rates were detected by the log-rank test. P<0.05 was considered to indicate a statistically significant difference.

A RT-qPCR assay was performed to evaluate the relative DCP1a mRNA expression levels in the clinical carcinoma and non-carcinoma tissue specimens of 118 CRC cases. The result was analyzed by Student's t-test, and as indicated in Fig. 1 the expression level of DCP1a was significantly increased in the carcinoma specimens compared with the non-carcinoma tissues (P=0.0024). This indicates that DCP1a may be a diagnostic biomarker for patients with colorectal carcinoma.

Immunohistochemical staining was performed to investigate the expression levels of DCP1a in the tissues, and the results are presented in Fig. 2A. It was identified that DCP1a protein exhibited a visibly higher expression in carcinoma tissues compared with the non-carcinoma tissues. In addition, the results of 3 representative samples from the western blot analysis are presented, demonstrating the protein levels of DCP1a in the carcinoma and non-carcinoma tissues (Fig. 2B). The results of western blot analysis indicated that the DCP1a protein level in the CRC samples was markedly increased compared with non-carcinoma tissues, with the exception of 32 cases. The underlying mechanism requires additional exploration.

According to the level of DCP1a expression compared with the non-carcinoma tissues, the cases were divided into low expression (n=32) and high expression (n=86) groups; levels of DCP1a expression higher compared with the non-carcinoma tissues were categorized as high expression. The clinicopathological parameters were collected and are summarized in Table I, and the differences between the two groups were evaluated using the χ² test. No statistically significant association was identified between the expression of DCP1a, and age, sex and tumor location. Conversely, an association was identified between a high expression of DCP1a in patients with CRC and deeper levels of invasion (P=0.008), a higher rate of lymph node metastasis (P=0.001), and later TNM stage (P=0.001). In conclusion, the results obtained indicate that the expression of DCP1a may serve a role in the development and progression of colorectal carcinoma.

As the survival curve suggests in Fig. 3, the low DCP1a-expression group exhibited an increased survival rate at the end of follow-up in comparison with the high-expression group (P=0.001). Additional analysis of the clinicopathological characteristics with respect to carcinoma-specific survival is summarized in Table II. Cox regression analysis revealed that the DCP1a expression (P=0.003), depth of invasion (P=0.023), lymph node metastasis (P<0.001) and TNM stage (P<0.001) had a significant effect on survival rate. In summary, the high expression of DCP1a may lead to poorer prognosis in the patients with CRC compared with patients with low DCP1a expression. These data suggest that DCP1a may be a useful prognostic indicator in clinical practice.