NSCLC tissues and normal lung tissues were obtained from 40 paired patients all of whom signed written informed consent after surgery at The Eastern Medical District of Linyi People's Hospital (Linyi, China). Then, we stored the samples in a −80°C refrigerator. All the experiments were approved by the Ethics Committee of The Eastern Medical District of Linyi People's Hospital (Linyi, China).

The NSCLC cell lines (A549, H226, H1650, H1299, SPC-A1) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) containing 10% fetal bovine serum, penicillin (100 U/ml) and streptomycin (100 U/ml), which was incubated at 37°C in a 5% CO₂ environment.

miR-196b mimic, miR-196b inhibitor, control mimic and control inhibitor were transfected to A549 cells or H226 cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) the next day when the cells were 70–80% confluent.

The GATA6 plasmid was purchased from GeneCopoeia (Germantown, MD, USA), and transfected in A549 cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

After transfection for 48 h, RIPA lysis containing proteinase inhibitors (Beyotime Institute of Biotechnology, Haimen, China) was used to extract total protein. The protein concentrations were tested with the BCA kit (Beyotime Institute of Biotechnology). The total proteins (50 µg) were added into the well with SDS-PAGE and electrophoresis at 60 V was performed when bromophenol blue ran out of the bottom. The proteins were then transferred to nitrocellulose filter (NC) membranes, and skimmed milk (5–10%) was used to block he membranes at room temperature for 2 h. Subsequently, primary antibodies (GATA6, Abcam, Cambridge, UK; GAPDH, Cell Signaling Technology, Inc., Danvers, MA, USA) were added in to incubate the samples at 4°C overnight. After being washed with 1X TBST (pH 7.4) three times, the secondary antibodies were added in and incubated at room temperature for 2 h. Protein bands were detected using the chemiluminescence method (ECL; Millipore Billerica, MA, USA). GAPDH served as a loading control.

We used TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) to extract total RNA from the cell lines or tissue samples (Invitrogen; Thermo Fisher Scientific, Inc.), then, we used the BioPhotometer (Eppendorf, Hamburg, Germany) to determine the concentration of the total RNA. All-in-One™ miRNA First-Strand cDNA synthesis kit was used to synthesize cDNA, and RT-qPCR was performed using the TaqMan PCR probes. The of the primer sequences were as follows: miR-196b-F: TAG GTACCACTTTATCCCGTTCACCA, miR-196b-R: ATC TCGAGGCAGGGAGAGAGGAATAA; GATA6-F: CTC CAACTTCCACCTCTTCTAAC, GATA6-R: TGGTGTGGT GGAGTCG; U6-F: GCCCATCTTGACCCGAAT, U6-R: AACGCTTCACGAATTTGCGT; GAPDH-F: ACAGTCAG CCGCATCTTCTT, GAPDH-R: ACGACCAAATCCGT TGACTC. GAPDH and U6 were used as endogenous controls. Relative expression levels of genes analysed were calculated using the 2^−ΔΔCq method.

A549 and H226 cell migration was measured using a Transwell chamber with a polycarbonic membrane with 8-mm pore size in vitro. NSCLC cells were treated with different transfection for 24 h. Then, 1×10⁵ cells were seeded into the upper chamber and a complete culture medium with 20% FBS was added to the lower chamber as an attractant. After incubation for 24 h at 37°C, in a 5% CO₂ environment, the media were removed. The cotton swabs were used to remove the cells from the top chamber. Moreover, the 100% methanol was used to fix the cells migrated to the lower membrane and 0.1% crystal violet was used to stain the migrating cells. The number of cells was quantified by a microscope (Olympus, Tokyo, Japan).

A549 and H226 cells invasion was measured using a millicell invasion chamber with 8-μm pore size polycarbonate membranes (Neuro Probe Inc., Gaithersburg, MD, USA) pre-coated with 2 mg/ml Matrigel (BD Bioscience, San Jose, CA, USA). Then 1×10⁵ cells were added to the upper chamber coated with Matrigel and a complete culture medium with 20% FBS was added to the lower chamber as an attractant and invaded for 24 h. The cotton swabs were used to remove the cells in the top chamber. Moreover, 100% methanol was used to fix the invaded cells to the lower membrane and 0.1% crystal violet was used to stain the invading cells. The number of cells was quantified by microscope (Olympus).

The wild-type and mutated miR-196b putative targets on GATA6 3′UTR were cloned into pGL3-promoter vector, a final concentration of 100 nM of cells of different transfection treatments were collected 48 h after transfection using Lipofectamine 2000, and luciferase activity was assayed with the dual-luciferase reporter assay system (Promega, Madison, WI, USA).

The experiments were repeated three times. SPSS v.19.0 software (IBM Corp., Armonk, NY, USA) was used to perform the statistical analyses as well as GraphPad Prism 5.02 software (GraphPad Software, Inc., La Jolla, CA, USA) to complete graph presentations. All data were presented as mean ± SD. Students t-test or post hoc test after one-way analysis of variance (ANOVA) in SPSS were used to analyze the differences between the groups. P<0.05 was considered to indicate a statistically significant difference.

First, we investigated the miR-196b expression in eight NSCLC tissue specimens and their corresponding non-cancerous tissue (NCT) specimens using RT-qPCR. The results showed that the miR-196b expression was markedly higher in NSCLC samples (Fig. 1A). The role of miRNA via targeting the 3′-UTR of mRNA is involved in the regulation of gene expression. Then, we used the TargetScan and miRanda to verify the direct target of miR-196b and it was found that GATA6 may be the target of miR-196b. The predicted target sites between miR-196b and GATA6 are shown in Fig. 1B. It is generally considered that the expression level of miRNAs and their target genes are opposite. Next, we investigated the GATA6 protein level in the same eight NSCLC and non-cancerous tissues, as shown in Fig. 1C. The GATA6 protein expression level was conspicuously lower in the NSCLC than in normal tissues, while the GATA6 mRNA level varied randomly (Fig. 1D). Regression analysis of correlation was used to show the relationship between the miR-196b and GATA6 protein levels (Fig. 1E) and miR-196b and GATA6 mRNA levels (Fig. 1F). We found that the inverse correlation coefficient (r=−0.7394) between the miR-196b expression and GATA6 protein level was higher than that of the miR-196b expression and GATA6 mRNA level (r=−0.3375). The results strongly suggested that miR-196b enhanced NSCLC cell migration and invasion by downregulating the GATA6 protein level and not the mRNA level.

To further examine the relationship between miR-196b and GATA6, we evaluated the GATA6 expression in A549 and H226 cells after transfection with miR-196b mimic or inhibitor (Fig. 2A). It was shown that GATA6 protein level was markedly reduced after the overexpression of miR-196b but significantly increased when silencing miR-196b in A549 and H226 cells (Fig. 2B). However, the GATA6 mRNA level did not change for overexpressed or silenced miR-196b (Fig. 2C), suggesting that miR-196b regulated GATA6 expression at the post-transcriptional level.

We used dual luciferase reporter assay to detect the predicted sequence binding sites of miR-196b and GATA6. As shown in Fig. 2D, the luciferase reporter activity in the miR-196b mimic group was obviously lower, whereas the luciferase reporter activity in the miR-196b inhibitor group was obviously higher than that in the control group (Fig. 2D). Then, we detected miR-196b binding ability in the mutated type of miR-196b. The results showed that miR-196b mimic or miR-196b inhibitor group exert no effect on the luciferase reporter activity (Fig. 2D). Thus, miR-196b inhibited GATA6 translation by binding to the 3′-UTR of GATA6.

We used the Transwell assay to investigate the role that miR-196b and GATA6 played on NSCLC migration. The miR-196b mimic group showed an enhanced migration, whereas the miR-196b inhibitor group showed a decreased migration (Fig. 3A and B). Moreover, the overexpression of GATA6 decreased cell migration, while miR-196b mimic promoted cell migration. However, re-expression of both miR-196b and GATA6 showed lower migration than the cell overexpression of miR-196b alone (Fig. 3C and D), suggesting that GATA6 may attenuate the promotion effect of miR-196b on NSCLC migration. In conclusion, miR-196b may promote NSCLC cell migration by targeting GATA6.

Next, we used the Transwell assay to investigate the role that miR-196b and GATA6 played in NSCLC invasion. The miR-196b mimic group showed increased invasion, while, the miR-196b inhibitor group showed decreased invasion (Fig. 4A and B). Moreover, the overexpression of GATA6 decreased cell invasion, while the miR-196b mimic promoted cell invasion. However, re-expression of both miR-196b and GATA6 showed lower invasion than that of the cell overexpression of miR-196b alone (Fig. 4C and D), suggesting that GATA6 may attenuate the promotion effect of miR-196b on NSCLC invasion. In conclusion, miR-196b may promote NSCLC cell invasion by targeting GATA6.