F. nucleatum strain was purchased from the American Type Culture Collection (ATCC 25586; Manassas, VA, USA). F. nucleatum was cultured in Columbia blood agar supplemented with 5 µg/ml hemin, 5% defibrinated sheep blood (5%) and 1 µg/ml vitamin K1 (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) in an anaerobic glove box containing 85% N₂, 10% H₂ and 5% CO₂ at 37°C. Escherichia coli strain DH5α (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was propagated in Luria-Bertani medium (Difco; BD Biosciences, Franklin Lakes, NJ, USA) aerobically at 37°C.

The human normal colon epithelial cell line NCM460 was obtained from Incell Corporation, LLC (San Antonio, TX, USA). NCM460 cells were cultured in RPMI-1640 medium (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (Hyclone; GE Healthcare Life Sciences) at 37°C in a humidified atmosphere containing 5% CO₂.

NCM460 cells (1×10⁶ cells/well) were seeded into a 6-well plate to form a confluent monolayer and cells were wounded using a pipette tip. Cells were incubated with F. nucleatum or E. coli DH5α at a multiplicity of infection (MOI) of 1,000:1. Images were captured at 6, 24, 48 and 72 h. The wound size of each well was calculated as the distance between the edges. The images were captured under a light microscope (magnification, ×40; XDS-500D; Shanghai Caikon Optical Instrument Co., Ltd., Shanghai, China).

NCM460 cells were seeded in 24-well plates at a density of 1×10⁴ cells/well with 1 ml complete RPMI-1640 medium (Hyclone; GE Healthcare Life Sciences). Cells were incubated with F. nucleatum or E. coli DH5α at an MOI of 1,000:1. Cells treated with PBS were used as a negative control. Cell numbers were calculated using a hemocytometer and cell proliferation was analyzed using a Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc., Kumamoto, Japan), according to the manufacturer's protocol.

NCM460 cells (~1×106) cells were trypsinized at room temperature for 2 min, washed twice with PBS and fixed in 70% ice-cold ethanol for 1 h at room temperature. The samples were centrifuged at 300 × g for 5 min at 4°C, the ethanol was removed and they were exposed to 100 mg/ml RNaseA (Sigma-Aldrich; Merck KGaA) for 30 min at 37°C. Cellular DNA was stained with propidium iodide (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Cell-cycle distributions were determined by flow cytometry using a BD FACSCalibur system (SKU#: 8044-30-1001, BD Biosciences, Franklin Lakes, NJ, USA) and data was analyzed using the ModFit software (version 4.1; Verity Software House, Inc., Topsham, ME, USA).

NCM460 cells were lyzed using radioimmunoprecipitation buffer (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). A BCA kit (Pierce; Thermo Fisher Scientific, Inc.) was used to determine the protein concentration. Equal quantities of protein (15 µg) were separated by SDS-PAGE (10% gels). Electrophoresed proteins were transferred onto nitrocellulose membranes. The membranes were then blocked with 5% fat-free milk suspended in TBS-T buffer for 2 h at room temperature and incubated with the following primary antibodies at 4°C overnight: Anti-phospho-p65, a subunit of nuclear factor-κB (NF-κB) (cat. no. ab86299, Abcam, Cambridge, MA, USA), anti-interleukin (IL)-6 (cat. no. ab6672, Abcam), anti-IL-1β (cat. no. ab156791, Abcam), anti-matrix metalloproteinase (MMP)-13 (cat. no. ab39012, Abcam), anti-E-cadherin (cat. no. ab1416, Abcam), anti-β-catenin (cat. no. ab32572, Abcam) and anti-GAPDH (cat. no. ab8245, Abcam). Following several washes with TBST, the membranes were incubated with HRP-conjugated goat anti-rabbit IgG (1:5,000; cat. no. ZB-2306, Zhongshan Gold Bridge Biological Technology Co., Beijing, China) for 2 h at room temperature and then washed. The proteins were detected using enhanced chemiluminescence, according to the manufacturer's protocol (Merck KGaA). ImageJ 1.8.0 (National Institutes of Health, Bethesda, MD, USA) was applied to quantify the relative protein levels. GAPDH was used as an internal control.

Total RNA was extracted from NCM460 cells using TRIzol^® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The concentration and the purity of the RNA samples were assayed by absorbent density analysis using an optical density (OD) ratio of 260/280 nm. A total of 2 µg RNA was reverse-transcribed using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). The PCR amplifications were performed in a 10-µl reaction system containing 5 µl SYBR Green Supermix (Tarkara, Japan) on Bio-Rad iQ5 Optical System (Bio-Rad Laboratories, Inc., Hercules, California, USA), 0.4 µl forward primer, 0.4 µl reverse primer, 2.2 µl double-distilled water and 2 µl template cDNA. The following thermal cycling conditions were used for the qPCR: Initial denaturation at 95°C for 10 min, 40 cycles of 95°C for 15 sec and a final extension at 60°C for 1 min. mRNA levels were determined using the 2^−ΔΔCq method (18). The data was analyzed using Bio-Rad CFX Manager 3.1 (Bio-Rad Laboratories, Inc.). GAPDH was used as a reference gene. The primers used in the current studies were as follows: TNFα-forward: CTGGGCAGGTCTACTTTGGG; TNFα-reverse: CTGGAGGCCCCAGTTTGAAT; IL6 foward: AGTGAGGAACAAGCCAGAGC; IL6 reverse: AGCTGCGCAGAATGAGATGA; IL-1β foward: CTTAAAGCCCGCCTGACAGA; IL-1β reverse: ACACTGCTACTTCTTGCCCC; MMP-13 foward: AGGCCATGGCATCCCTTTTT; MMP-13 reverse: AGCACCCTCCCCAAGTATCA; GAPDH foward: GAGAAGGCTGGGGCTCATTT; GAPDH reverse: AGTGATGGCATGGACTGTGG.

Cells were transfected with small interfering RNA (siRNA) targeting E-cadherin (si-E-cadherin) or β-catenin (si-β-catenin), or with negative control siRNA (NC; 5′-ACUAGUCGAUCUAUGUGUGAUATT-3′) (Shanghai GenePharma Co., Ltd., Shanghai, China) using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at the indicated concentrations, according to the manufacturer's protocol. In brief, NCM460 cells (1×10⁶ cells/well) were seeded in a six well plate with 2 ml RPMI-1640 medium. At 60% confluence, 50 nM si-E-cadherin or 50 nM si-β-catenin or 50 nM NC was mixed with Lipofectamine^® 2000 at room temperature for 20 min. Then, the mixture was added into each well at a final concentration of 20 nM for 48 h. Then, the cells were collected for further analysis.

NCM460 cells were cultured in a 6-well plate with glass coverslips and were fixed in 4% paraformaldehyde for 30 min at room temperature. The samples were washed three times in PBS for 5 min. Following washing with PBS three times for 5 min, the slides were blocked with 8% bovine serum albumin (Sigma-Aldrich; Merck KGaA) at room temperature for 2 h The coverslips were incubated with antibodies against E-cadherin (1:50; cat. no. ab1416, Abcam) and β-catenin (1:50; cat. no. ab32572, Abcam) in a humidified chamber overnight at 4°C. After that the slides were washed with PBS for three times and incubated with tetramethylrhodamine-conjugated anti-rabbit immunoglobulin G (1:500; cat. no. ZDR5209, Zhongshan Gold Bridge Co.) and with DAPI (1:1,000; cat. no. C0060, Solarbio Science & Technology Co., Ltd.) for 20 min at room temperature. Following incubation with the secondary antibody, the slides were washed three times with PBS in the dark and the coverslips were mounted with a mounting medium and coated on glass slides. The slides were sealed at room temperature for ~1 h in the dark and fluorescence intensity was examined using a fluorescence microscope.

Data are presented as the mean + standard deviation for the indicated number of separate experiments. A total of three independent experiments were performed for each experiment. Differences in the quantitative data between two groups were determined using the unpaired Student's t-test. Comparisons of means among multiple groups were determined using one-way analysis of variance. All statistical analyses were performed using GraphPad Software (version 6.0; GraphPad Software, Inc., La Jolla, CA, USA). All P-values were two-tailed. P<0.05 was considered to indicate a statistically significant difference.

First, the function of F. nucleatum in the proliferation and invasion of NCM460 cells was investigated. The results indicated that F. nucleatum significantly enhanced the proliferation of NCM460 cells at 24, 48 and 72 h, compared with the control and E. coli DH5α groups (Fig. 1A). Additionally, flow cytometric analysis of the cell cycle revealed an increased proportion of cells at S and G₂/M phase in response to F. nucleatum treatment (Fig. 1B). F. nucleatum also increased the invasive ability of NCM460 cells at 48 h compared with the control and E. coli DH5α groups (Fig. 1C).

Increasing evidence has indicated the important function of pro-inflammatory factors during tumorigenesis (19,20). Therefore, whether F. nucleatum infection regulates signaling was also evaluated. F. nucleatum infection significantly enhanced the phosphorylation levels of p65 and the expression of IL-6, IL-1β and MMP-13 (Fig. 2).

Attachment and invasion are hallmarks of F. nucleatum. Therefore, the effects of F. nucleatum infection on the induction of EMT were also assessed. At 48 h post-infection, epithelial cells transdifferentiated into mesenchymal-like cells as observed using microscopy (Fig. 3A). Furthermore, F. nucleatum infection did not alter the protein levels of E-cadherin and β-catenin as demonstrated using western blot analysis (Fig. 3B), indicating that F. nucleatum infection induced EMT without affecting the expression of E-cadherin.

To further elucidate the underlying molecular mechanism of F. nucleatum in malignant transformation of NCM460 cells, E-cadherin or β-catenin expression was silenced in NCM460 cells (Fig. 4A and B). An immunofluorescence assay revealed decreased expression of E-cadherin or β-catenin in NCM460 cells following transfection with si-E-cadherin or si-β-catenin for 48 h (Fig. 4C). qPCR was performed to evaluate the expression levels of inflammatory factors, including tumor necrosis factor (TNF)-α, IL-6, IL-1β and MMP-13. The results indicated that F. nucleatum did not increase the mRNA levels of TNF-α, IL-6, IL-1β and MMP-13 in NCM460 cells when E-cadherin was silenced (Fig. 4D). However, increased expression of TNF-α, IL-6, IL-1β and MMP-13 was identified in NCM460 cells when transfected with si-β-catenin (Fig. 4E). Additionally, F. nucleatum infection did not increase the proportion of cells at S phase when E-cadherin was silenced, but it increased the number of cells at S phase when NCM460 cells were transfected with si-β-catenin (Fig. 4F). These results indicated that although E-cadherin or β-catenin are required for tumor growth and inflammatory responses, E-cadherin and β-catenin are differentially regulated by F. nucleatum infection.