Mouse MFBs (MIC-iCell-c002, iCell Bioscience Inc., Shanghai) were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a 5% CO₂ atmosphere at 37°C. The cells were observed with an inverted microscope (×40 magnification). si-SMOC1 (GGGAAGTCAAGGTCAGTACG) or si-negative control (NC) (GGGAAGTCAAGGTCAGTACG), was cloned into the psiRNA-h7SK vector (Biovector Science Lab, Inc.). The plasmid (1 µg) was transfected into the cells with Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). The cells were incubated at 37°C for 6 h; and then the cells were transferred into fresh DMEM and maintained for 18 h at 37°C. Then the cells were used to perform the following experiments.

Six treatment groups were created in the present research, including a control group (MFBs without treatment), a negative control (NC) group (MFBs transfected with an empty vector), an si-SMOC1 group (MFBs transfected with si-SMOC1), an Ang II group [MFBs treated with 1 µM Ang II (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 18 h at 37°C], an Ang II+NC group (MFBs transfected with an empty vector and then treated with 1 µM Ang II) and an Ang II+si-SMOC1 group (MFBs transfected with si-SMOC1 and then treated with 1 µM Ang II).

A Cell Counting kit-8 assay (CCK-8; Beyotime Institute of Biotechnology, Haimen, China) was performed to measure cell viability. Approximately 6×10⁴ MFBs/ml in the logarithmic phase were seeded into 96-well plates and maintained in an incubator at 37°C in 5% CO₂ for 12 h. Subsequently, cells were divided into the aforementioned treatment groups. Cells were maintained for 12, 24 and 48 h, respectively. Subsequently, 10 µl CCK-8 reagent was added to each well and cells were maintained for 3 h at 37°C. A microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used to measure the absorbance at 450 nm. Cell viability was evaluated by the percentage of surviving cells compared with the control.

MFBs were trypsinized by 0.25% trypsin (Beyotime Institute of Biotechnology) and collected in Eppendorf tubes. Cells were then washed with PBS. Subsequently, cells were re-suspended with serum-free Dulbecco's modified Eagle medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 2′-7′-dichlorofluorescin diacetate (D6883, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at a density of 1×10⁶ cells/ml and incubated for 0.5 h at 37°C. Following centrifugation at 224 × g for 1 min at room temperature, the supernatant was discarded and cells were collected. Cells were re-suspended with PBS and a FACSCalibur flow cytometer with CellQuest software version 3.3 (BD Biosciences, Franklin Lakes, NJ, USA) was used to assess the reactive oxygen species (ROS) content.

The following kits were used: LDH assay kit (Abcam, Cambridge, UK), MDA assay kit (Beyotime Institute of Biotechnology, Haimen, China) and SOD assay kit (Sigma-Aldrich; Merck KGaA). All assays were performed according to the manufacturer's protocol.

The expression of TGF-β1, COL-I and COL-III were determined by ELISA kits: Mouse TGF-β1 ELISA Kit (E-EL-M0051c; Elabscience, Wuhan, Hubei, China), COL1 ELISA kit (E-EL-M0325c; Elabscience) and COL-III ELISA kit (E-EL-M0316; Elabscience). According to the manufacturer's protocol, MFBs (6×10³/well) were added into 96-well plate. The plates were sealed with adhesive tape and maintained at 37°C for 90 min. Subsequently, 100 µl biotinylated antibody fluids were added. The plates were sealed with adhesive tape and maintained at 37°C for 60 min. Next, 100 µl HRP conjugate enzyme binding solutions were added. The plates were sealed with adhesive tape and maintained at 37°C for 30 min. Substrate regent (100 µl) was added and plates were maintained for 10–15 min in the dark at 37°C. Subsequently, stop solution was added and mixed in for 10 min immediately. The OD450 value was detected using a microplate reader (Bio-Rad Laboratories, Inc.).

The proteins were isolated with NP40 lysis buffer (Beyotime Institute of Biotechnology). The protein concentration was measured by bicinchoninic assay protein assay kit (Pierce; Thermo Fisher Scientific Inc.). 20 µg protein was separated by 12% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 5% skimmed milk at room temperature for 2 h. The primary antibodies were incubated with the membranes at 4°C overnight. Western blotting was performed using the following specific antibodies: Rabbit anti-mouse anti-SMOC1 (dilution, 1:500; catalog no., ab200219; Abcam, Cambridge, MA, USA), rabbit anti-mouse anti-fibronectin (FN) (dilution, 1:1,000; catalog no., ab131390; Abcam), rabbit anti-mouse anti-TGF-β1 (dilution, 1:1,000; catalog no., ab92486; Abcam), rabbit anti-mouse anti-COL-I (dilution, 1:500; catalog no., ab64883; Abcam), rabbit anti-mouse anti-COL-III (dilution, 1:5,000; catalog no., ab7778; Abcam), rabbit anti-mouse anti-BMP2 (dilution, 1:500; catalog no., ab14933; Abcam), rabbit anti-mouse anti-Smad2 (dilution, 1:1,000; catalog no., ab33875; Abcam), rabbit anti-mouse anti-p-Smad2 (dilution, 1:1,000; catalog no., ab53100; Abcam), and rabbit anti-mouse anti-actin (dilution, 1:5,000; catalog no., ab179467; Abcam). The membranes were subsequently incubated with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (dilution, 1:2,000; catalog no., ab205718; Abcam) at room temperature for 1 h. Enhanced chemiluminescent (ECL) reagents (EMD Millipore) and an ECL system (GE Healthcare, Chicago, IL, USA) were used to assess the results. The density of the blots was analyzed by Quantity One software version 4.6.9 (Bio-Rad Laboratories).

Total RNA was extracted from cultured MFBs using TRIzol reagent (Thermo Fisher Scientific, Inc.). RNA was reverse transcribed to cDNA using a Reverse Transcription kit (Sigma-Aldrich; Merck KGaA), according to the manufacturer's protocols. RT-qPCR was performed using SYBR-Green PCR master mix (Vazyme, Piscataway, NJ, USA) on ABI 7500 Thermocycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 5 min pretreatment at 95°C; 94°C for 15 sec, 60°C for 45 sec (35 cycles); final extension at 76°C for 10 min and maintenance at 4°C. Actin was used as the control of the input RNA level. The method of quantification was according to 2^−∆∆Cq method (21). The primers used, designed by Invitrogen; Thermo Fisher Scientific, Inc., were as follows: SMOC1 forward, 5′-CCAAGCCCAAGAAATGTGCC-3′ and reverse, 5′-AGTCCTGTCTCCTCGGAGTT-3′ (227 bp); FN forward, 5′-TGACAACTGCCGTAGACCTG-3′ and reverse, 5′-CACTGGGGTGTGGATTGACC-3′ (232 bp); TGF-β1 forward, 5′-GTCCAAACTAAGGCTCGCCA-3′ and reverse, 5′-ATAGATGGCGTTGTTGCGGT-3′ (202 bp); COL-I forward, 5′-ATTTGTGCGTCGGTTGGGTA-3′ and reverse, 5′-GTTGTGTTCTGAAGCCACGG-3′ (298 bp); COL-III, forward, 5′-GCTACAGGCCTTTTGTTGGC-3′ and reverse, 5′-CCACAGAATGGGTGGGAGAC-3′ (222 bp); and actin, forward, 5′-TGCCCGGTGCTTTAGACTAC-3′ and reverse, 5′-AAATAATGAACCCAGCCAGCC-3′ (171 bp).

The results of the present study are presented as the mean ± standard error of the mean of at least three independent experiments. All of the experimental data were analyzed by one-way analysis of variance following Tukey's test. P<0.05 was considered to indicate a statistically significant difference. GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA) was used for data analysis.

Over the course of the present study, mouse MFBs were cultured with DMEM containing 10% FBS. As demonstrated in Fig. 1, the morphology of the MFBs was spindle-shaped and polygonal. Furthermore, large nuclei and clear cytoplasms were observed in the MFBs. Therefore, MFBs were harvested and used for the subsequent experiments.

A siRNA vector targeting SMOC1, si-SMOC1, was constructed in the present study. The knockdown efficiency was ~75% in MFBs following stable transfection with si-SMOC1 (P<0.01; Fig. 2A). According to the results of western blot analysis, it was revealed that, following transfection with si-SMOC1, the protein expression level of SMOC1 was significantly reduced (P<0.01; Fig. 2B). Therefore, a CCK-8 assay was performed to measure the cell viability of MFBs separated into the six treatment groups described earlier. The results demonstrated that, the cell viability was inhibited in si-SMOC1 group compared to Ang II group (Fig. 2C).

Additionally, the ROS content in MFBs of the previously described treatment groups was also assessed. A significant increase in ROS content was observed in the Ang II group compared with the NC group (P<0.01; Fig. 3). However, it was also revealed that the ROS content in Ang II-induced MFBs was significantly reduced by transfection with si-SMOC1 (P<0.01; Fig. 3). Therefore, it has been determined that SMOC1 silencing is able to reduce the production of ROS in MFBs treated with Ang II.

The MDA and LDH content in MFBs treated with Ang II were significantly higher than in the NC group (P<0.01; Fig. 4A-B). However, significant decrease in MDA and LDH content in Ang II-treated MFBs transfected with si-SMOC1 were observed (P<0.05; Fig. 4A-B). Nevertheless, Ang II was revealed to inhibit the activity of SOD in MFBs. In the SMOC1-silenced group, the SOD activity in Ang II-treated MFBs was significantly enhanced (P<0.05; Fig. 4C). In summary, it was confirmed that SMOC1 silencing reduced the MDA and LDH content, whereas enhancing SOD activity in Ang II-induced MFBs. Therefore, SMOC1 silencing mitigated oxidative stress in MFBs induced by Ang II.

Furthermore, the present study investigated the molecular mechanisms underlying fibrosis in MFBs and the expression levels of fibrosis-associated proteins, including FN, TGF-β1, COL-I and COL-III in MFBs. On the basis of ELISA data, it was revealed that SMOC1 silencing significantly decreased the expression of TGF-β1, COL-I and COL-III in Ang II-treated MFBs (P<0.05; Fig. 5A). Furthermore, the RT-qPCR results indicated that the expression levels of FN, TGF-β1, COL-I and COL-III in Ang II-treated MFBs were significantly downregulated in response to si-SMOC1 (P<0.05; Fig. 5B). Western blot analysis results also revealed similar trends in the expression of fibrosis-associated proteins in MFBs from each group (Fig. 5C). Based on these results, it was confirmed that SMOC1 silencing suppressed fibrosis of Ang II-treated MFBs through downregulating the expression levels of FN, TGF-β1, COL-I and COL-III.

Finally, the expression levels of BMP2, phosphorylated Smad2 and Smad2 in MFBs from each group were evaluated. Western blot analysis results revealed that the expression levels of BMP2 and phosphorylated Smad2 in Ang II-treated MFBs were significantly downregulated in response to si-SMOC1 (P<0.05; Fig. 6). Therefore, it was determined that SMOC1 silencing was able to suppress the phosphorylation of Smad2 in Ang II-treated MFBs. Additionally, there was no significant difference in the Smad2 expression in MFBs from each group (Fig. 6). Therefore, it was concluded that SMOC1 silencing affected the BMP2/Smad pathway in Ang II-treated MFBs.