The CRC cell lines SW-480, SW-620, HT-29, HCT-116 and normal colon epithelial cell line FHC were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 medium (Pan Biotech GmbH, Aidenbach, Germany) supplemented with 10% fetal bovine serum (FBS) (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in humidified atmospheric conditions of 5% CO₂. For transfection, miR-410 mimics (AUCAUGAUGGGCUCCUCGGUGUACACCGAGGAGCCCAUCAUGAU), miR-410 inhibitors (UAGUACUACCCGAGGAGCCACAUGUGGCUCCUCGGGUAGUACUA) and a negative control inhibitor (NC inhibitor) were constructed by Biossci Biotechnology Co. (Wuhan, China, http://www.biossci.com/). Transfections were performed using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The concentration of miR-410 mimics was 50 nmol/l and of miR-410 inhibitors was 100 nmol/l, following instructions from Biossci Biotechnology Co. Cells were harvested after 48 h for further analyses.

Total RNA was isolated from SW-480 and HT-116 cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The RNA purity was determined by a DU800 UV/Vis Spectrophotometer (Beckman Coulter, Inc., Brea, CA, USA) and 100 ng RNA was used for complementary DNA (cDNA) synthesis using the ReverTra Ace-α-kit (Toboyo Life Science, Osaka, Japan) following the manufacturer's protocol. qPCR was performed using SYBR Green Real-Time PCR Master mix (Toyobo Life Science). The expression of miR-410 and DKK1 mRNA was normalized to U6 and β-actin, respectively. PCR was performed with the following thermocycling conditions: Initial denaturation at 94°C for 4 min, 40 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 25 sec, using the ABI 7900 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific Inc.), according to the manufacturer's protocols. The relative amount of miRNA or mRNA was calculated via the 2^−∆∆Cq method (17) and the primer sequences used are shown in Table I.

The viability of SW-480 and HT-116 cells was measured by a cell viability test, using Cell Counting Kit-8 (CCK-8; Beyotime Institute of Biotechnology, Jiangsu, China). Cells were inoculated into 96-well plates at a density of 2×10³ cells/well for 24 h and then transfected with miR-410 inhibitor or NC inhibitor according to the aforementioned manufacturer's protocol. SW-480 and HT-116 cells were stained with 20 µl of CCK-8 reagent for 4 h before detecting the absorbance at 450 nm using a Multiskan FC spectrophotometer (Thermo Fisher Scientific, Inc.).

Cell apoptosis was examined using the Annexin V-FITC/Propidium Iodide (PI) staining kit (Dojindo Molecular Technologies, Inc., Kumamoto, Japan). SW-480 and HT-116 cells were seeded in 6-well plates at a density of 10⁶ cells/ml. At 24 h after transfection, the cells were labeled with Annexin V-FITC for 15 min in the dark. A total of 50 µg/ml of PI was added to each sample for 30 min. Cell apoptosis distribution was analyzed to evaluate the percentage of apoptotic cells by flow cytometry using a BD LSR II flow cytometer (BD Biosciences, San Jose, CA, USA).

Cell invasion and migration assays were performed using Transwell plates (Corning Life Sciences, NY, USA) with 8-µm-pore size membranes with Matrigel (for invasion assay) or without Matrigel (for migration assay). SW-480 and HT-116 cells were used at 48 h post-transfection with miR-410 inhibitor or NC inhibitor. Briefly, 3×10⁴ cells were seeded in the upper chamber while medium containing 10% FBS was placed in the lower chamber. After incubation at 37°C for 24 h, cells on the upper chamber membrane were wiped away. Then, cells on the lower chamber membrane were stained with 0.2% crystal violet for 30 min. Five predetermined fields were counted under a Olympus BX50 light microscope (magnification, ×100; Olympus Corporation, Tokyo, Japan). All assays were performed in triplicate.

To explore the association between miR-410 and DKK1, an in silico prediction was performed using open access software (TargetScan, http://www.targetscan.org; PicTarget, https://pictar.mdc-berlin.de/ and miRanda http://microrna.org). A putative binding site for miR-410 was identified within the 3′-UTR of DKK1.

The putative and mutated miR-410 target binding sequences in DKK1 were synthesized and cloned into luciferase reporters to generate the wild-type (DKK1-WT) or mutated-type (DKK1-MUT) reporter plasmids. The mutant 3′-UTR sequence of DKK1 was obtained using an overlap-extension PCR method (18). Then, the sequences including the predicted wild and mutant target sites were subcloned into a psiCHECK-2 vector (Promega Corporation, Madison, WI, USA), and validated by sequencing by Sangon Biotech Co., Ltd. (Shanghai, China). For the luciferase reporter assay, SW-480 cells were seeded at 1×10⁵ cells/well on a 24-well plate. The cells were then co-transfected with miR-410 inhibitor or NC inhibitor using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. Cells were harvested at 48 h post-transfection and luciferase activities were compared with Renilla luciferase activity using a Dual-Luciferase Reporter Assay system (Promega Corporation).

Total cellular proteins were lysed using RIPA Buffer (Beyotime Institute of Biotechnology), followed by centrifugation at 15,000 × g for 20 min at 4°C. A bicinchoninic acid assay (Beyotime Institute of Biotechnology) was performed to quantify protein concentrations. Briefly, equivalent amounts of protein of 30 µg per lane were resolved by 10% SDS-PAGE gel electrophoresis and subsequently blotted onto polyvinylidene difluoride membranes followed by blocking at 4°C for 1 h with TBS containing 0.05% Tween-20 (TBST) buffer with 5% non-fat milk and incubation with the following primary antibodies: Anti-DKK1(dilution, 1:1,000; cat. no. ab109416); anti-β-catenin (dilution, 1:5,000; cat. no. ab32572); anti-GSK-3β (dilution, 1:5,000; cat. no. ab32391) (all from Abcam, Cambridge UK); and anti-phosphorylated glycogen synthase kinase-3β (p-GSK-3β) (dilution, 1:1,000; cat. no. D85E12; CST Biological Reagents Co., Ltd., Shanghai, China) at 4°C overnight. GAPDH was used as a loading control. After washing with TBST buffer, membranes were incubated with goat anti-rabbit IgG antibody (dilution, 1:100; cat. no. LK2003; Sungene Biotech, Co., Ltd, Tianjin, China) at room temperature for 1 h. All bands were visualized with an ECL system kit [MultiSciences (Lianke) Biotech Co., Ltd, Hangzhou, China]. Densitometry was performed by ImageJ 1.48 software (National Institutes of Health, Bethesda, MD, USA).

All statistical analyses were performed using SPSS 19.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 5.0 (GraphPad Software, Inc., La Jolla, CA, USA). Data are presented as the mean ± standard deviation. Differences were assessed by two-tailed Student's t-test, analysis of variance and a Student-Newman-Keuls post hoc test as appropriate. All experiments were performed at least three times. P<0.05 was considered to indicate a statistically significant difference.

To investigate whether miR-410 is involved in CRC development, miR-410 levels in four CRC cell lines (SW-480, SW-620, HT-29 and HCT-116) were examined by RT-qPCR. As shown in Fig. 1, the data demonstrated that miR-410 expression was significantly upregulated in CRC cell lines compared with the control. SW-480 and HT-116 cell lines were employed in subsequent experiments.

To investigate the effect of miR-410 in CRC development, miR-410 inhibitor and NC inhibitor were used to evaluate the biological properties of miR-410 in SW-480 and HT-116 cells. Transfection efficiency was determined using RT-qPCR. As the results demonstrate, miR-410 expression was significantly inhibited in SW-480 cells and significantly upregulated in HT-116 cells following transfection with miR-410 inhibitor and miR-410 mimics, respectively (Fig. 2A). The results of the CCK-8 assay revealed that knockdown of miR-410 significantly inhibited cellular viability compared with NC group, while miR-410 overexpression markedly promoted cellular viability (Fig. 2B). In addition, flow cytometry data demonstrated that apoptotic rate of SW-480 was significantly increased by miR-410 inhibitor, while the apoptotic rate of HT-116 cells was suppressed by miR-410 mimics compared with NC group (Fig. 2C). The current data demonstrated that miR-410 is closely associated with cell proliferation and apoptosis in CRC cells.

To delineate the role of miR-410 in the metastasis of CRC, a Transwell assay was employed to evaluate the migration and invasion capacity of CRC cells. It was identified that downregulation of miR-410 significantly inhibited cell migration in SW-480 and HT-116 cells (Fig. 3A and B). Compared with NC inhibitor, the number of invaded cells was dramatically reduced when cells were treated with miR-410 inhibitor (Fig. 3C and D). These results suggest that miR-410 promotes the migration and invasion capacity of CRC cells.

An open access database was employed to predict the putative binding sequences between miR-410 and DKK1. To further confirm whether DKK1 is a direct target of miR-410, the luciferase reporter vectors of the DKK1 3′-UTR containing miR-410 binding sites (DKK-1 WT), or a mutated version (DKK-MUT), were constructed. Co-transfection was performed with miR-410 inhibitor (or NC inhibitor) and DKK-1 WT (or DKK-1 MUT) plasmids into SW480 cells. A dual-luciferase reporter assay was used to measure the reporter activities of the different constructs. The results revealed that knockdown of miR-410 significantly increased reporter vector activity of DKK-1 3′-UTR in SW-480 cells but had no effect on the mutated reporter vector (Fig. 4A and B). To further explore the modulation of DKK1 expression by miR-410, western blot and RT-qPCR analyses were performed. It was demonstrated that miR-410 silencing led to an increase in the DKK1 expression level (Fig. 4C-E). The current results indicate that miR-410 directly targets DKK1 and negatively regulates DKK1 expression.

To further investigate whether miR-410 affected Wnt/β-catenin signaling pathways, SW-480 cells were transfected with miR-410 inhibitor or NC inhibitor. As shown in Fig. 5, western blot analysis revealed that downregulation of miR-410 significantly decreased β-catenin and p-GSK-3β protein levels in SW-480 cells. However, there was no difference in the level of GSK-3β with regard to miR-410 downregulation. Collectively, these results demonstrate that miR-410 may be an important regulator in the Wnt/β-catenin signaling pathways.