Osteosarcoma (OS) is an aggressive malignant neoplasm that arises from primitively transformed cells of mesenchymal origin, and that exhibits osteoblastic differentiation and produces malignant osteoid. MicroRNAs (miRNAs) have been widely reported to have important regulatory roles in various human tumors, including OS. However, the potential mechanism of miR-29 in OS remains largely unknown. miR-29 was highly expressed in OS and overexpression of miR-29 promoted OS cell proliferation, as well as proliferating cell nuclear antigen (PCNA) expression and migration, whereas lower expression of miR-29 inhibited OS cell proliferation, PCNA expression and migration. In the present study, a dual-luciferase reporter system supporting phosphatase and tensin homolog (PTEN) was a target of miR-29 and its expression was inhibited by miR-29 mimic, but increased by miR-29 inhibitor. Overexpression of PTEN inhibited OS cell proliferation and migration and it could attenuate miR-29 promotion effect on OS progression. Overall, the results revealed that miR-29, as a tumor promoter, is involved in OS progression and metastasis by targeting PTEN, indicating that the miR-29/PTEN pathway is a potential therapeutic target for the treatment of OS.
Osteosarcoma (OS) is a malignant bone tumor characterized by tumor cells directly forming bone or bone tissues. It often occurs in adolescents or children under the age of 20 and the prognosis is poor (
It is known that, miRNAs can extensively disrupt various functions of different cancers by targeting mRNA (
The miR-29 family contains three mature members (miR-29a, miR-29b and miR-29c). An increasing number of studies have shown the decreased expression of miR-29 family in various types of cancer and that it has the ability to suppress tumors, including breast, bladder and pancreatic cancer (
It is well known that phosphatase and tensin homolog (PTEN) acts as a tumor suppressor and PTEN expression was proved abnormal in many cancers (
In our study, miR-29 and PTEN in OS and its potential mechanism in modulating OS cell migration and proliferation was investigated. Our results may provide important insight into the prognosis and treatment of OS.
We collected conventional OS and adjacent non-cancerous tissues from 60 patients who underwent resection surgery in the First Affiliated Hospital of Zhengzhou University (Zhengzhou, China) between February 2010 and August 2016. None of OS patients had received radiotherapy or chemotherapy before surgery and the tissues were diagnosed as OS by pathologists. All tissue specimens were placed into liquid nitrogen immediately and stored at −80°C in a refrigerator for use in subsequent experiments. The Ethics Committee of Zhengzhou University approved this study and the patients signed informed consent prior to surgery.
The purchased OS cell lines (MG-63, U2OS, 143B, Saos-2) were cultured in RPMI-1640 medium at 37°C and the medium contained 20% FBS and penicillin (100 U/ml) and streptomycin (100 µg/ml). hFOB1.19 (normal human osteoblast) cells were cultured in DMEM supplemented with 10% FBS and G418 (0.03 mg/ml) at 34°C with 5% CO2. OS cell lines (MG-63, U2OS, 143B, Saos-2) and hFOB1.19 (normal human osteoblast) cells were obtained from ATCC (Manassas, VA, USA).
miR-29 mimic or inhibitor provided by Suzhou GenePharma Co., Ltd. (Suzhou, China) was transfected into MG-63 cells to facilitate or inhibit miR-29 expression and control mimic were used as control (con). We added MG-63 cells into 24-well plates containing medium and we performed transfection using Lipofectamine 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) for 48 h. PTEN vector and con vector were synthesized by GenePharma Co., Ltd. and they were used to enforce PTEN expression and acted as a control separately.
Total RNA and microRNA were extracted from OS tissues and cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Complementary DNA was synthesized using PrimeScript RT reagent kit and RT-qPCR was performed using SYBR Premix Ex Taq (both from Takara Biotechnology Co., Ltd., Dalian, China) with the Stratagene Mx3000P real-time PCR system (Agilent Technologies, Inc., Santa Clara, CA, USA). The primer sequences used were: miR-29-F: TGCCAGGAGCTGGTGATTTCCT, miR-29-R: ACGGGCGTACAGAGGATCCCC. PTEN-F: GTGCAG ATAATGACAAG, PTEN-R: GATTTGACGGCTCCTCT. proliferating cell nuclear antigen (PCNA)-F: GGTGTTG GAGGCACTCAAGG, PCNA-R: CAGGGTGAGCTGCACC AAAG. U6-F: CTCGCTTCGGCAGCAC, U6-R: ACGCTTC ACGAATTTGC. β-actin-F: GA TCATTGCTCCTCCTGAGC; β-actin-R: ACTCCTGCTTGCTGATCCAC. U6 and β-actin were used as internal controls. Relative expression of miR-29, PTEN and PCNA was calculated by the 2−ΔΔCq method (
Lysis buffer containing protease inhibitor and phenylmethanesulfonyl fluoride (PMSF) was added into OS tissues or cells and then homogenized on ice (the written informed consent from patients were obtained). After centrifugation at 12,000 × g, at 4°C for 30 min, the supernatant was measured by BCA kit. Then, 50 µg protein specimens at the same concentration were added onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were then transferred to polyvinylidene fluoride (PVDF) membranes and blocked with skim milk (5–10%) at room temperature for 2 h subsequently. Then primary antibodies, monoclonal rabbit anti-PTEN (1:1,000, cat. no. 9188; Cell Signaling Technology, Inc., Danvers, MA, USA), monoclonal mouse anti-actin (1:1,000, cat. no. sc-58673; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were added to incubate the membranes at 4°C overnight and secondary antibodies, monoclonal goat anti-rabbit or anti-mouse IgG-HRP (1:2,000, cat. no. sc-2004; Santa Cruz Biotechnology, Inc.) were later added to incubate the membranes at room temperature (25°C) for 2 h. Finally, the enhanced chemiluminescence kit (ECL; Merck Millipore, Billerica, MA, USA) was used to detect the signals. The relative expression of target proteins was evaluated using target protein/β-actin.
Transwell assay was used to measure cell migration. Transwell inserts with 8 µm pore size polycarbonic membrane (Corning Costar Corp., Cambridge, MA, USA) were used to divide Transwell chamber into upper and lower chambers. MG-63 cells (5×105/well) with different transfection were placed into the top chambers and DMEM containing 10% FBS into lower chambers and then cultured for 48 h at 37°C under CO2 atmosphere. The cells from the top chambers migrated into the lower chambers, and the cells on the top chambers were removed with cotton. The cells were fixed on lower chambers using 4% formaldehyde for 30 min at room temperature (25°C), cells were stained with 0.1% crystal violet for 15 min, and images of the cells were captured using an inverted microscope (Nikon 80i, Feasterville, PA, USA). Cells were then counted using Living Image Version 4.5 Software (PerkinElmer, Inc., Waltham, MA, USA) image software.
Fresh culture (100 µl) medium was added into 96-well plates to replace the culture medium when the MG-63 cell population reached optimal densities. Then, MTT reagent (20 µl) was added and cultured at 37°C for 4 h. Subsequently, the MTT medium was sucked out and 100 µl of DMSO was added for additional 10 min, the plates were read at a wavelength of 570 nm using the multilabel plate reader (PerkinElmer, Inc.) at 1, 2, 3, 4 days to measure the absorbance of each well.
TargetScan Human 7.1 was firstly carried out to identify the possible targets of miR-29. We used Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) to co-transfect miR-29 mimic or control mimic with 3′-UTR of wild or mutated PTEN in MG-63 cells. The dual luciferase reporter system (GeneCopoeia, Inc., Rockville, MD, USA) was then used to measure the luciferase activity of MG-63 cells treated with different transfection.
All experiments were repeated three times independently. SPSS v.19.0 software (IBM Corp., Armonk, NY, USA) was used to perform statistical analyses and GraphPad Prism 5.02 software (GraphPad Software, Inc., La Jolla, CA, USA) to complete graph presentations. Results are presented as the mean ± standard deviation, and the data were evaluated using Student's t-test or Tukey's post hoc test after ANOVA in SPSS. P<0.05 was considered to indicate a statistically significant difference.
Our primary aim was to explore miR-29 role in OS. First, we detected miR-29 level in OS tissues and cells using RT-qPCR. As shown in
Secondly, we measured miR-29 effect on OS progression. We overexpressed miR-29 in MG-63 cells using miR-29 mimic, and mRNA expression was increased significantly (
We then silenced miR-29 using miR-29 inhibitor to further confirm its effect on OS. The transfection efficiency is shown in
The next step was to investigate miR-29 molecular mechanism in OS. TargetScan Human 7.1 was carried out to identify the possible targets of miR-29 and results are shown in
Then, we investigated the role of PTEN in OS and whether PTEN affected the miR-29 role in regulating OS progression. PTEN was overexpressed by PTEN vector due to its lower expression in OS. The results showed that PTEN expression was higher after cells were transfected with PTEN vector (
An increasing number of studies have reported the important roles of miRNAs in tumorigenesis and tumor development (
PTEN was the first tumor suppressor gene found with a bispecific phosphatase activity and closely associated with carcinoma (
In conclusion, miR-29 facilitated OS migration and proliferation and this is the first report that miR-29 targeted PTEN and regulated OS development. Furthermore, PTEN could reverse miR-29 promotion effect on OS providing a new idea for OS therapy.
Not applicable.
This study received the specific grant from the Co-construction project of Henan Provincial Medical Science and Technology Key Project (grant no. 201401007).
The datasets generated or analyzed during the present study are available from the corresponding author on reasonable request.
QL was a major contributor in writing the manuscript and contributed to the conception of the study. PG contributed significantly to data analysis and manuscript preparation. LS performed the data analyses and wrote the manuscript. QW and PW helped perform the data analysis with constructive discussions. All authors read and approved the final study.
The study was approved by the Ethics Committee of The First Affiliated Hospital of Zhengzhou University (Zhengzhou, China). Signed informed consents were obtained from all participants.
Not applicable.
The authors declare that they have no competing interests.
miR-29 is increased in OS. (A) Quantification of miR-29 average expression in OS tissues (n=60). (B) miR-29 measured in OS cells and normal cells. (C) Quantification of miR-29 expression in different stages of OS. **P<0.01, ***P<0.001; ##P<0.01. OS, osteosarcoma.
miR-29 mimic promoted OS cell migration and proliferation. (A) Quantification of miR-29 mRNA and protein level in MG-63 cells treated with miR-29 mimic. (B and C) Detection of cell viability by MTT and PCNA expression using RT-qPCR after MG-63 cells restoration of miR-29. (D) Measurement of cell migration by Transwell after MG-63 cell restoration of miR-29. **P<0.01. OS, osteosarcoma; con, control.
miR-29 inhibitor curbed OS cell migration and proliferation. (A) Quantification of miR-29 mRNA and protein level in MG-63 cells treated with miR-29 inhibitor. (B and C) Detection of cell viability by MTT and PCNA expression by RT-qPCR after MG-63 cells silencing miR-29. (D) Measurement of cell migration by Transwell after MG-63 cell silencing by miR-29. *P<0.05, **P<0.01, ***P<0.001. OS, osteosarcoma; PCNA, proliferating cell nuclear antigen.
PTEN is a target of miR-29 in OS. (A) Binding sites of PTEN and miR-29. (B) PTEN protein and mRNA expression detected in MG-63 cells after restoration or silencing miR-29. (C) Detection of PTEN luciferase activity in MG-63 cells after beingtreated with PTEN 3′-UTR WT or MUT and miR-29 mimic. (D) Detection of the relevance of miR-29 and PTEN expression (r= −0.8670, P<0.0001). **P<0.01. OS, osteosarcoma; PTEN, phosphatase and tensin homolog.
PTEN attenuates miR-29 promotion effect on OS cell migration and proliferation. (A) PTEN mRNA and protein expression quantified in MG-63 cells after overexpression of PTEN. (B) Measurement of cell migration by Transwell after MG-63 cell overexpression of PTEN. (C) Detection of cell viability by MTT and PCNA expression using RT-qPCR after MG-63 cells after overexpression of PTEN. (D) Detection of cell viability by MTT and PCNA expression by RT-qPCR after MG-63 cell re-expression of miR-29 alone or both miR-29 and PTEN. (E) Detection of cell migration by Transwell after MG-63 cell re-expression of miR-29 alone or both miR-29 and PTEN. *P<0.05, **P<0.01, ***P<0.001; #P<0.05, ##P<0.01. OS, osteosarcoma; PTEN, phosphatase and tensin homolog; PCNA, proliferating cell nuclear antigen.