Samples of glioma and matched non-tumor tissues were collected from 15 patients at Affiliated Chenggong Hospital (Xiamen, China). A total of 40% patients were female and 60% were male, the median age was 45 years, ranging from 14–74 years. Patients with malignant peripheral nerve sheath tumors or other unrelated neurologic tumors were excluded. Informed consent was obtained from all patients or family members, and the study protocol was approved by the Ethical Committee of Affiliated Chenggong Hospital. All tissues were snap-frozen and stored in liquid nitrogen prior to use. A further 20 paraffin-embedded samples obtained from Pathology Department of Affiliated Chenggong Hospital. Only samples that were diagnosed with WHO stage II and IV disease were chosen.

Human glioma expression microarray data were downloaded from The Cancer Genome Atlas (TCGA) (http://cancergenome.nih.gov/), and were used to analyze difference in the expression of SIRT7 between normal brain and glioma tissues.

The U251 cell line was obtained from the China Center for Typical Culture Collection. Professor Xiuwu Bian (The Third Military Medical University, Chongqing, China) kindly provided the glioma CHG5 and SHG44 cell lines. U87 cell lines were purchased from the American Type Culture Collection (Manassas, VA, USA). This cell line has been reported to be misidentified/contaminated. This is not the original glioblastoma cell line established in 1968 at the University of Uppsala; as described in PubMed=27582061 (18). However, this cell line exhibits Sirt7 overexpression and meets our research requirements, it does not interfere with our experimental conclusions. Cells were cultured in DMEM (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% FBS (Gemini Bio Products, West Sacramento, CA, USA) at 37°C in a humidified atmosphere containing 5% CO₂.

Owing to transfection efficiency considerations and the background high expression of Sirt7 in U87 and U251 cell lines, these two cell lines were chosen in the knockdown experiment. Two siRNAs targeting at Sirt7 (target sequence: 5′-GTGGACACTGCTTCAGAAA-3′ and 5′-CGAAGCTTTACATCGTGAA-3′) were synthesized by Guangzhou RiboBio Co., Ltd., (Guangzhou, China). Cells were seeded into a 6-well plate at 50–60% confluence, and were then transfected with oligonucleotides at a final concentration of 20 nM with the DharmaFECT reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After 6 h, the transfection medium was replaced with 2 ml DMEM. The cells were collected for the following assays after 48 h.

Cells were harvested and lysed in radioimmunoprecipitation assay lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1% NP-40 and 0.5% sodium deoxycholate) The BCA Protein Assay kit was used to determine the protein concentrations according to the manufacturer's instruction (Pierce; Thermo Fisher Scientific, Inc.). Equal amounts of total proteins (25 µg) were subjected to 10% SDS-PAGE. They were then transferred to polyvinylidene difluoride membrane, incubated with 5% BSA (Sangon Biotech, Co, Ltd., Shanghai, China) blocking buffer for 1 h at room temperature and then incubated overnight with primary antibody at 4°C. The primary antibodies used were as follows: Sirt7 (cat. no. 5360), STAT3 (cat. no. 4904), p-STAT3 (cat. no. 9145), CDK2 (cat. no. 2546), MMP-9 (cat. no. 3852) (all from Cell Signaling Technology, Inc., Danvers, MA, USA, and used at a dilution of 1:1,000), and β-actin (cat. no. SC-130300, Santa Cruz Biotechnology, Inc., Dallas, TX, USA). The membranes were then incubated with the horseradish peroxidase-conjugated secondary antibody (Anti-mouse IgG, cat. no. 7076; Anti-rabbit IgG, cat. no. 7076; from Cell Signaling Technology, Inc., Danvers, MA, USA, and used at a dilution of 1:10,000). Immunoreactive bands (cat. no. WBKLS0500; Millipore Immobilon Western, ECL; EMD Millipore, Billerica, MA, USA) were quantified using ImageJ software (v.1.48; National Institutes of Health, Bethesda, MD, USA).

The archived paraffin- embedded tissues were cut to a thickness of 4 µm. Immunostaining was performed using the two-step Elivision Plus kit system (Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China). The sections were dewaxed in xylene, rehydrated with a series of ethanol solutions (100, 95, 80 and 70%), and then boiled in citrate buffer (pH 6.0) for 2 min in an autoclave. Next, 0.3% H₂O₂ was used to block endogenous peroxidase activity at room temperature for 15 min, and the sections were incubated with normal goat serum (dilution ratio 1:20) for 20 min at room temperature to reduce non-specific binding. Tissue sections were incubated with the Sirt7 antibody (cat. no. 5360s; 1:150 dilution; Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. The secondary antibody was applied using the Envision Detection kit (Dako; Agilent Technologies, Inc., Santa Clara, CA, USA). Slides were stained for 2 min with diaminobenzidine tetrahydrochloride (DAB) and then counterstained 2 min with hematoxylin at room temperature. The stained tumor cells were assessed with a Nikon microscope in 10 independent fields at magnification, ×400.

An MTS assay was used to detect cell proliferation. Cells were plated in 96-well plates at 1×104 cells/well and cultured for 4 h before each of the treatment durations (24, 36 and 48 h). A total of 20 µl MTS was added to each well and then incubated for 4 h at 37°C. The absorbance of each sample was measured at 490 nm using a microplate reader.

Cells were seeded at a density of 1,000 per well into a 6-well culture dish and incubated at 37°C. Culture medium was replaced with fresh medium every two days. After 3 weeks, cells were washed with PBS and stained with Gimesa stain for 20 min at room temperature (EMD Millipore). Only colonies with >50 cells were counted. A total of 12 random fields were counted under an upright light microscope at magnification, ×200. All experiments were performed in triplicate.

An in vitro cell invasion assay was performed using a 24 well-plate transwell insert (EMD Millipore) coated with Matrigel (EMD Millipore). A total of 0.5 ml of prepared serum-free suspension of transfected cells (24 h after transfection), with a total cell count of 1×10⁵, were added into the upper chamber (8-µm pore size), 0.5 ml cell culture medium containing 10% FBS was added to the lower chamber of the insert. After incubation for 24 h, non-invading cells in the interior of the insert were removed using a cotton swab. The invasive cells on the lower surface of the insert were treated with Gimesa stain (1:9) for 20 min at room temperature and average percentage of positive tumor cells were assayed in 10 independent fields at magnification, ×200 under an upright light microscope for research and clinical use. All experiments were performed in triplicate.

Total RNA was extracted from tissues and cells using Tripure Isolation reagent (Roche Applied Science, Penzberg, Germany), according to the manufacturer's instructions. The Transcription First Strand cDNA Synthesis kit (Roche Applied Science) was used to synthesize cDNA from 1 µg total RNA. The primers sequences used are as follows: SIRT7, forward, CAGGGAGTACGTGCGGGTGT, and reverse, TCGGTCGCCGCTTCCCAGTT; GAPDH, forward, AAGTGAAGCAGGAGGGTGGAA, and reverse, CAGCCTCACCCCATTTGATG. The thermocycling conditions were as follows: Initial denaturation at 94°C for 5 min, followed by 30 cycles at 94°C for 45 sec, 59°C for 45 sec and 72°C for 45 sec, followed by 72°C for 45 sec and finally one cycle at 72°C for 10 min. Experiments were performed in triplicate with SYBR Green I Master mix (Roche Applied Science); GAPDH was used as the internal control. The results were normalized using the 2^−ΔΔCq method (19).

All quantified data represented an average of at least three samples. Graph Pad Prism v.5.0 (GraphPad Software, Inc., La Jolla, CA, USA) and SPSS v.16 (SPSS, Inc., Chicago, IL, USA) were used for statistical analysis. The data are expressed as the mean ± standard deviation. Comparisons between different groups were performed with Student's t-test and one way analysis of variance followed by a Student-Newman-Keuls post hoc test. P<0.05 was considered to indicate a statistically significant difference. TCGA statistical analysis was performed using the Mann-Whitney U-test test.

To examine the physiological relevance of Sirt7 in human glioma development, the expression level of Sirt7 was analyzed in clinical patient samples using a Sirt7-specific antibody. The samples were obtained from 15 patients who were classified into different grades according to their pathological diagnoses. The characteristics of the glioma patients are summarized in Table I. As shown in Fig. 1A, Sirt7 was positively expressed in tumors compared with paired adjacent non-tumor tissues. To confirm this finding, RT-qPCR and western blot analysis was performed, which revealed that Sirt7 mRNA was significantly elevated in glioma compared to the normal tissues, as was that of Sirt7 protein (Fig. 1B and C). Besides, to determine whether the levels of Sirt7 expression were associated with the grade of pathological classification, the expression level of Sirt7 was assessed in grade II and grade IV tumors. The results of this analysis revealed that Sirt7 expression was higher in grade IV than grade II gliomas (Fig. 1D).

Owing to the limited number of fresh samples, TCGA database was used to analyze the difference in expression between the normal and glioma groups. Data from 698 GBM patients and 5 control group patients were extracted from TGCA database. Expression of Sirt7 was significantly higher in the GBM patients than in the control individuals (Fig. 1E). Additionally, the pathology database was accessed and paraffin specimens (20 specimens, 9 for grade II and 11c for grade IV) were obtained. IHC assays revealed the presence of strong Sirt7 staining in the nuclei of high-grade gliomas (Fig. 1F). These results indicated that Sirt7 may have a role in the development of glioma.

To understand the potential functions of Sirt7 in glioma cells, the expression level of Sirt7 was analyzed in the human glioma CHG5, SHG44, U87 and U251 and one normal glial HEB cell lines (20). The CHG5 and SHG44 cell lines were derived from grade II tissues, whereas U87 and U251 cell lines were obtained from grade IV tissues. Sirt7 expression was higher in glioma cells than in normal glial cells (Fig. 2A). Compared with the low-grade CHG5 and SHG44 cells, U251 and U87 cells expressed an even higher level of Sirt7, in accordance with the results from the aforementioned experiments.

As the glioma cell lines in the present study exhibited high Sirt7 expression levels, Sirt7 was not overexpressed. However, two different siRNAs targeting Sirt7 were transfected into cells, and the efficiency of Sirt7 knock down was determined by western blot analysis and RT-qPCR. Compared with the control group, the protein and mRNA expression levels of Sirt7 in the si-Sirt7 group were significantly decreased (Fig. 2B and C).

The aforementioned observations prompted the investigation of the biological function of Sirt7 in the tumorigenesis of glioma cells, which was achieved by performing MTS assays to evaluate the effect of Sirt7 on cellular proliferation. At 24 h after siRNA transfection up to 72 h, the proliferation of cells was assessed (Fig. 3A). The results demonstrated that knockdown of Sirt7 reduced the proliferation of cells in the si-Sirt7 groups when compared to the group transfected with the nonsense control siRNA. Whether Sirt7 affected the tumorigenesis of glioma cells was next assessed by detecting the colony formation ability of glioma cells following transfection. The results showed that Sirt7 knockdown significantly reduced the number of colonies formed (Fig. 3B).

Invasive ability is one of the features that best reflects the malignancy of glioma cells. Thus, the effects of Sirt7 on cell invasion was assessed by Matrigel invasion assays. Sirt7 was knocked down in the U87 and U251 cell lines by transfection with si-Sirt7. The si-Sirt7 group exhibited reduced invasion into the lower chamber compared to the control group (Fig. 4A and B; P<0.01). Depletion of Sirt7 significantly reduced cell invasion, indicating that Sirt7 may participate in the progression of glioma.

To investigate the molecular mechanism by which downregulation of Sirt7 inhibited glioma cell proliferation and invasion, whether knockdown of Sirt7 influenced ERK signaling activation was examined. The level of p-ERK decreased when Sirt7 expression was suppressed (Fig. 5A and B). Compared with the control group, the si-Sirt7 group exhibited a decrease in the levels of p-STAT3 and MMP9. To determine the function of Sirt7 in cell cycle progression, Sirt7 downregulation was performed, which decreased the expression of CDK2 (Fig. 5A and B), indicating that Sirt7 may participate in cell cycle regulation, which could further influence the glioma tumorigenesis.