Contributed equally
BRAC1 has multiple important interactions with triple-negative breast cancer, the specific molecular characteristics of this interaction, however, have not yet been completely elucidated. By examining cell signaling pathways, important information for comprehending the potential mechanisms of this cancer may become known. The aim of the present study was to identify the effects of BRAC1 and to find the signaling pathway(s) involved in the pathogenic mechanism of triple-negative breast cancer. In this study, GSE27447 microarray data were obtained from the Gene Expression Omnibus (GEO) database of the National Center for Biotechnology Information, and differentially expressed genes (DEGs) from GSE27447 were distinguished by Significant Analysis of Microarray. Gene ontology (GO) analysis was carried out on 132 upregulated and 198 downregulated genes with DAVID. The signaling was forecast by the Kyoto Encyclopedia of Genes and Genomes (KEGG). Transcription factors were recognized by TFatS. The BRAC1 relevant protein-protein interaction networks (PPI) were fixed by STRING and visualized by CytoScape. Overall, the upregulated DEGs, which included CR2, IGHM, PRKCB, CARD11, PLCG2, CD79A, IGKC and CD27, were primarily enriched in the terms associated with immune responses, and the downregulated DEGs, which included STARD3, ALDH8A1, SRD5A3, CACNA1H, UGT2B4, SDR16C5 and MED1, were primarily enriched in the hormone metabolic process. In addition, 13 pathways, such as the B-cell receptor-signaling pathway, the hormone synthesis signaling pathway and the oxytocin-signaling pathway, were chosen. MYC, SP1 and CTNNB1 were determined to be enriched in triple-negative breast cancer. A total of 8 genes were identified to be downregulated in the BRAC1-related PPI network. The results of the present study show a fresh angle on the molecular mechanism of triple-negative breast cancer and indicate a possible target for its treatment.
Breast cancer is a malignant tumor with high incidence and heterogeneity in females worldwide (
Over the past 20 years, our research has focused exclusively on surgery and chemotherapy to understand the molecular subtypes that cause major changes in clinical practice (
Breast cancer susceptibility gene 1 (BRCA1) is a well-established tumor suppressor gene, which is linked to hereditary breast cancer (
The Affymetrix microarray data were obtained from the National Center for Biotechnology Information Gene Expression Omnibus database (
The DEGs were ascertained by means of Significant Analysis of Microarray (SAM) (
The transcription factor target genes associated with DEGs were evaluated by using a bioinformatics tool named TFatS (
BRCA1 and DEGs were mapped to the CHARACTER STRING database to discover the possible interacting proteins. CHARACTER STRING (
Patients with breast cancer were chosen from the pathological diagnosis of Changzheng hospital, including three TNBC patient samples and three non-TNBC patient samples from ACKERMAN PATHOLOGY & DIAGNOSTICS center, and total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. The present study was approved by the Ethics Committee of Changzheng Hospital, Second Military Medical University (Shanghai, China). Patients provided written informed consent.
According to the instructions included in the PrimeScript™ RT reagent Kit (Perfect Real Time) (TaKaRa Bio, Inc., Otsu, Japan) kit, the RT reaction was performed for the mRNA (37°C for 15 min or 85°C for 5 sec) and miRNA (42°C for 60 min or 70°C for 10 min). Then, they were subjected to an RT reaction using the ABI 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific, Inc.). The miRNA primers were designed by Guangzhou RiboBio Co., Ltd (Guangzhou, China). The fold-changes for miRNA and mRNA expression were calculated by the 2−ΔΔCq method. The amplification primers of CR2, PRKCB, CARD11, PLCG2, CD79A, CD27, STARD3, SRD5A3, CACNA1H, UGT2B4, SDR16C5 and MED1 were then designed (
Patient sample was homogenized in a lysis buffer (P0013; Beyotime Institute of Biotechnology, Haimen, China) supplemented with 1% protease inhibitor cocktail (Pierce; Thermo Fisher Scientific, Inc.). Antibodies against the following proteins were used for Western blot analysis: MYC (1:1,000 dilution; no. #2272; Cell Signalling Technology, Inc., Danvers, MA, USA), SP1 (1:1,000 dilution; no. #5931; Cell Signalling Technology, Inc.,), β-actin (1:1,000 dilution; no. #4967; Cell Signalling Technology, Inc.,) and CTNNB1 (1:1,000 dilution; Phospho-β-Catenin (Ser33/37) Antibody no. #2009; Cell Signalling Technology, Inc.). Following centrifugation at 12,000 × g for 30 min at 4°C, the supernatant was collected, and the protein concentration was determined using an enhanced bicinchoninic acid protein assay kit according to the manufacturer's protocol (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The membrane proteins were transferred to a polyvinylidene difluoride (PVDF) membrane following electrophoresis with 10% SDS-PAGE. The membranes were blocked with 5% non-fat dry milk in Tris-buffered saline prior to overnight incubation at 4°C, incubated with the primary antibodies and were then incubated with the secondary antibodies (Abmart, Shanghai China) for 60 min at 37°C. Following washing with TBST 3 times for 10 min each, the membranes were developed with an enhanced chemiluminescent ECL assay kit (Santa Cruz Biotechnology, Inc., Dallas, TX, USA).
Data are presented as the mean ± standard error of the mean. The primary data were formatted into expression measurements and normalized by the robust multi-array average (RMA) algorithm (
On the basis of the SAM analysis, a total of 132 upregulated and 198 downregulated DEGs were identified. The GO analysis was subsequently conducted (
On the basis of the SPIA analysis, a total of 13 KEGG signaling pathways were examined to determine if they were dysregulated in TNBC (
TFactS analysis was performed to ascertain transformation in the degree of transcription factor activity in upregulated and downregulated genes in TNBC (
The RT-qPCR results demonstrated that the expression of CR2, PRKCB, CARD11, PLCG2, CD79A and CD27 was increased, and the expression of STARD3, SRD5A3, CACNA1H, UGT2B4, SDR16C5 and MED1 was decreased in TNBC-patient samples (
Metastasis is the main cause of cancer-related death (
Breast cancer is the most common type of cancer in females worldwide, and is characterized by a high mortality rate (
GO analysis revealed that the upregulated genes were primarily concentrated in the immune response, including lymphocyte activation, cell cycle progression, leukocyte activation and B cell activation. Complement receptor type 2 (CR2; CD21), which binds fragments of C3, may ligate CD19 or CD23 to present antigens to B cells (
The results of the present study revealed that downregulated genes, including ALDH8A1 and SRD5A3, in TNBC were significantly concentrated in the hormone metabolic biological process. Retinoic acid (RA) is required for cellular differentiation and is known to arrest tumor development (
Signaling pathways serve an important role in the investigation of cancer pathogenesis (
Transcription factors are targets for certain anticancer drugs; however, a limited list of transcription factors are overactive in most human cancer cells, which makes them targets for the development of anticancer drugs. That they are the most direct and hopeful targets for treating cancer is proposed, and this is supported by the fact that there are many more human oncogenes in signalling pathways than there are oncogenic transcription factors (
The present study has helped to elucidate the molecular mechanisms of tumor development and metastasis. The BRCA1 mutation is associated with neoplastic transformation (
The present study demonstrated that the B cell receptor-signaling pathway and hormone synthesis-signaling pathway are of vital importance in the development of TNBC. In addition, numerous genes that may function as potential targets for TNBC have been identified. Nevertheless, to reveal TNBC's potential molecular mechanisms, further research should be performed to investigate other signaling pathways and key cancer-associated proteins.
The authors would like to thank Ackerman Pathology and Diagnostics Center (Shanghai China) for providing specimen tissues.
The present study was funded by Chinese National Science Foundation (grant no. 81502260, 2016).
The Affymetrix microarray data were obtained from the National Center for Biotechnology Information Gene Expression Omnibus database (
FQ and WXQ performed the majority of experiments; FQ, WXQ and YSZ provided vital reagents and analytical tools and were also involved in editing the manuscript; FQ and WXQ designed the study and wrote the manuscript. YSZ analyzed and interpreted the data, and agreed to be accountable for all aspects of the work in ensuring that question related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
The present study was approved by the Ethics Committee of Changzheng Hospital, Second Military Medical University (Shanghai, China). Patients provided written informed consent.
Not applicable.
The authors declare that they have no competing interests.
B-cell receptor pathway, which may be dysregulated in TNBC. Red boxes indicate upregulated genes, purple boxes indicate no differentially expressed genes. TNBC, triple negative breast cancer.
MAPK signaling pathway, which may be dysregulated in TNBC. Red boxes denote upregulated genes, and blue boxes denote downregulated genes, green and pink boxes represent indicate no differentially expressed genes. TNBC, triple negative breast cancer.
mTOR signaling pathway, which may be dysregulated in TNBC. Red boxes indicate upregulated genes and blue boxes indicate downregulated genes and green and pink boxes represent indicate no differentially expressed genes.
The expression of DEGs and transcription factors. (A) RT-qPCR confirmed the result of upregulated genes' mRNA expression (n=3). *P<0.05. (B) RT-qPCR confirmed the result of downregulated genes' mRNA expression (n=3). *P<0.05. (C) Western blot confirmed the result of TFs. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; DEG's differentially expressed genes; TF, transcription factor.
BRCA1 related protein-protein interaction network. The interaction network was predicated by STRING and visualized by Cytoscape software. Red indicates upregulated genes and green indicates downregulated genes and yellow indicates no differentially expressed genes.
Primers used in RT-qPCR.
Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
---|---|---|
CR2 | GGCTACCTTATGGCTGGAGAG | AGAGTCACAGTAGTCCCAAACC |
PRKCB | GCCTACCCCAAGGTCCATGT | CTTGGTCATGAGCCCTTTG |
CARD11 | CAGGGTGCCTGCCTCATAG | TATAGGGAGAAGCAAGGCAGGG |
PLCG2 | CTGGCAACCGACTCAAAGGA | GCTGATGCTGTTTCTTCGGG |
CD79A | CTACGGCTTCTCCAGCTGAAT | CAGCTGAATGTCTTCCTCACA |
CD27 | ATGGAAAGGGAAGCACGTC | TTGGCCAACTCCTCTCCTAA |
STARD3 | GACCTGGTTCCTTGACTTCAA | CGGCAAGACGTTTATCCTGAA |
SRD5A3 | TTTAATCAGGCCCTGTCTGC | GGGGTATAGAAATGGAATGGAGA |
CACNA1H | GGATCCCAAGCTTGGTACCG | CTTCATGGCCCTCTAGAGGATCC |
UGT2B4 | TGGACTCATCACCTGACTCATGTAA | GTCAAAGAGACTGCAGGAACATGA |
SDR16C5 | TGGAAACTCTTAAAGTTTTGCTCCTTACAATC | GAAAGATATTCATGGTGAATTCGAATC |
MED1 | GAGACTCCGCCCACTTACCTG | GGACACACTTCAAACTGGAGG |
GAPDH | ACGGCAAGTTCAACGGCACAG | CCACGACATACTCAGCACCAGC |
GO terms of DEGs.
A, The top 10 GO terms of the 132 upregulated DEGs | ||||
---|---|---|---|---|
Category | Term | Count | P-value | Genes |
GO:0046649 | Lymphocyte activation | 24 | 1.49×10−11 | GAPT, TCF7, CR2, IGHM |
GO:0045321 | Leukocyte activation | 25 | 4.68×10−11 | GAPT, TCF7, CR2, IGHM |
GO:0002684 | Positive regulation of immune system process | 27 | 2.66×10−10 | BLK, CR2, IGHM, PRKCB |
GO:0050778 | Positive regulation of immune response | 23 | 3.37×10−10 | CR2, IGHM, PRKCB, CARD11 |
GO:0006955 | Immune response | 33 | 1.46×10−9 | IL16, BLK, PAX5, GPRC5B |
GO:0002376 | Immune system process | 42 | 2.11×10−9 | IL16, BLK, PAX5, GPRC5B |
GO:0001775 | Cell activation | 25 | 2.52×10−9 | GAPT, TCF7, CR2, IGHM |
GO:0002682 | Regulation of immune system process | 30 | 6.97×10−9 | BLK, CR2, IGHM, PRKCB |
GO:0050776 | Regulation of immune response | 24 | 1.34×10−8 | CR2, IGHM, PRKCB, CARD11 |
GO:0042113 | B cell activation | 13 | 6.02×10−8 | GAPT, CR2, IGHM, PRKCB |
GO:0042445 | Hormone metabolic process | 10 | 5.45×10−5 | STARD3, TG, ALDH8A1, FOXA1 |
GO:0044699 | Single-organism process | 143 | 4.38×10−4 | PDP1, ALDH8A1, ADCY1, TSPAN1 |
GO:0034754 | Cellular hormone metabolic process | 7 | 5.22×10−4 | STARD3, ALDH8A1, SRD5A3, CACNA1H |
GO:0010817 | Regulation of hormone levels | 14 | 5.62×10−4 | ALDH8A1, TG, FOXA1, IYD |
GO:0009952 | Anterior/posterior pattern specification | 9 | 6.17×10−4 | HOXC10, MSX2, PCGF2, HOXC11 |
Fourteen pathways identified based on KEGG.
Pathway | Count | P-value | Genes |
---|---|---|---|
B cell receptor signaling pathway | 6 | 0.003988 | CARD11, CD19, CR2, PLCG2, CD22, CD79A |
Hormone synthesis | 5 | 0.022133 | TG, ADCY1, CREB3L4, PRKCB, IYD |
Oxytocin signaling pathway | 7 | 0.034094 | ADCY1, PLA2G4A, RGS2, RYR3, CACNG4, PRKAA2, PRKCB |
Hematopoietic cell lineage | 5 | 0.041129 | CD19, CR2, CD3E, MS4A1, CD22 |
Platelet activation | 6 | 0.049048 | ADCY1, PLA2G4A, FGA, RASGRP1, PLCG2, RASGRP2 |
Non-small cell lung cancer | 4 | 0.054172 | ERBB2, PLCG2, RARB, PRKCB |
Calcium signaling pathway | 7 | 0.056584 | ADCY1, CHRM3, ERBB2, RYR3, PLCG2, CACNA1H, PRKCB |
Wnt signaling pathway | 6 | 0.060444 | TCF7, DKK1, SFRP1, WIF1, FZD7, PRKCB |
Inflammatory mediator regulation of TRP channels | 5 | 0.063253 | ADCY1, PLA2G4A, P2RY2, PLCG2, PRKCB |
Melanogenesis | 5 | 0.067119 | ADCY1, TCF7, CREB3L4, FZD7, PRKCB |
Circadian rhythm | 3 | 0.081308 | RORC, PRKAA2, BHLHE41 |
Primary immunodeficiency | 3 | 0.095274 | CD19, CD3E, CD79A |
MAPK signaling pathway | 8 | 0.096136 | DUSP4, PLA2G4A, RASGRP1, RASGRP2, DUSP10, CACNG4, CACNA1H, PRKCB |
Results of the TfactS analysis.
Gene name | TF | Regulation |
---|---|---|
WIF1 | CTNNB1 | Up |
FZD7 | CTNNB1 | Up |
QPCT | CTNNB1 | Up |
TCF7 | CTNNB1 | Up |
SOX10 | CTNNB1 | Up |
INHBB | CTNNB1 | Down |
SEMA3C | CTNNB1 | Down |
DKK1 | CTNNB1 | Down |
MSX2 | CTNNB1 | Down |
AR | CTNNB1 | Down |
CEACAM6 | CTNNB1 | Down |
MUC6 | CTNNB1 | Down |
SCGB2A2 | CTNNB1 | Down |
CEACAM5 | CTNNB1 | Down |
CD19 | SP1 | Up |
UGT8 | SP1 | Up |
PLA2G4A | SP1 | Up |
PAPSS2 | SP1 | Down |
KRT19 | SP1 | Down |
AR | SP1 | Down |
CEACAM5 | SP1 | Down |
FOXA1 | SP1 | Down |
SLC9A2 | SP1 | Down |
RARB | MYC | Up |
SPIB | MYC | Up |
PLA2G4A | MYC | Up |
RGS2 | MYC | Up |
RPL23 | MYC | Down |
CEACAM5 | MYC | Down |