The wild-type KRAS isoform b precursor (NM_004985.3) was re-amplified from a previous clone in pGem^®-T Easy (Promega Corporation, Madison, WI, USA) available in the laboratory, using wild-type primers appended with restriction sites for HindIII and NotI at the 5′ and 3′ ends, respectively. The primers used to generate all KRAS variants used in this study are as follows: KRAS, F 5′-GCCGTCCTGAAGCTTCGCCGGATGACTGAATATAAACTTG-3′, R 5′-GTCGTGCCGCGGCCGCGTGCCGTTACATAATTACACACTTTG-3′; KRAS E31D, R 5′-GTTGGATCATAA*TCGTCCAC-3′, F 5′-GTGGACGAT*TATGATCCAAC-3′; KRAS E63K, R 5′-GCACTGTACTT*CTCTTGACC-3′, F 5′-GGTCAAGAGA*AGTACAGTGC-3′; KRAS G12D, F 5′-GCCGTCCTGAAGCTTCGCCGGATGACTGAATAT; AAACTTGTGGTAGTTGGAGCTGA*TGGCGTAGG-3′; KRAS G13D, F 5′-GCCGTCCTGAAGCTTCGCCGGATGACTGAATAT;AAACTTGTGGTAGTTGGAGCTGGTGA*CGTAGG-3′.

Site-directed mutagenesis by overlap extension PCR was used to generate the mutants. The general PCR components and conditions used in this study are as follows. Each reaction mixture contained a final concentration of 1X PCR buffer (Titanium^® Taq PCR buffer, Clontech Laboratories, Inc., Mountain View, CA, USA), 0.125 mM of each deoxynucleoside triphosphate (iNtRON Biotechnology, Inc., Sangdaewon-Dong, Jungwon-Seongnam, South Korea), 2 mM each of the appropriate forward and reverse primers, 1X Taq polymerase (Titanium^® Taq polymerase, Clontech Laboratories), and 50 ng of the cloned pTargeT™-KRAS WT template. The template DNA was initially denatured at 94°C for 5 min. Twenty cycles of denaturation at 94°C for 5 min, annealing at 55°C for 30 sec, and extension at 72°C for 1 min were then performed using the C1000 Touch™ Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Two fragments of the same mutant were then fused using overlap extension-PCR, where 25 ng of each fragment was used as a template with KRAS-F and KRAS-R as primers. The same PCR conditions stated above were used with the additions of a final extension step at 72°C for 10 min after 20 cycles of amplification to ensure the addition of A-overhangs for TA-cloning into the pTargeT™ mammalian expression vector (Promega Corporation). Amplified PCR products were cloned directly into pTargeT™ and verified error-free and in the correct orientation by Sanger sequencing.

NIH3T3 cells were purchased from the American Type Culture Collection (ATCC; Manassas, Virginia, USA; cat. no. CRL-1658). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% bovine calf serum (BCS; Gibco; Thermo Fisher Scientific, Inc.), 3 mg/ml sodium bicarbonate (NaHCO₃), 100 U/ml penicillin/streptomycin, and incubated in a humidified atmosphere containing 5% CO₂ at 37°C. Cells were seeded onto 12-well polypropylene culture plates. At 80–90% confluency, the cells in each well were transfected with 2 µg pTargeT™ construct, using 4 µl Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). A mammalian expression vector containing a green fluorescent protein gene reporter (pmR-ZsGreen1; Clontech Laboratories) was also transfected vis-à-vis the KRAS expression constructs to approximate transfection efficiency. For particular experiments, each pTargeT™ construct was co-transfected with pmR-ZsGreen1 in a 1:7 vector ratio (pmiR-ZsGreen1: pTargeT) to fluorescently track cells that were most likely transfected and are overexpressing the KRAS variant. Transfection efficiency was assessed by fluorescence microscopy between 24 and 72 h post-transfection, and the cells were observed or harvested for subsequent morphological, functional and molecular characterization experiments. Routinely and periodically, all constructs were also tested for ability to express the transcript and/or protein via RT-PCR and western blot, respectively.

Morphological appearance, including size, refringency, presence of filopodia, presence of lamellipodia, and depolarization of transfected fibroblasts was examined under an inverted brightfield microscope at 100× magnification 48 h post-transfection. To quantitatively compare the transforming effect on cellular morphology by the different forms of KRAS, percentage of cells exhibiting transformed characteristics was determined for each transfection setup. Each transfected well was imaged in three random fields of view. Using the Fiji opensource platform for biological image analysis (21), fibroblasts with aberrant morphology were counted for each documented field. A total cell count per view was also performed. The mean percentage of morphologically transformed cells was then computed for all fields of view. The values were then statistically compared among all transfectants.

NIH3T3 cells were seeded into an 8-well glass chamber slide (EMD Millipore, Burlington, MA, USA), and transfected the next day as described previously. Forty-eight hours post-transfection, the cells were fixed, permeabilized, and stained with a phalloidin fluorescent conjugate. All steps were performed at room temperature. Briefly, cells were washed twice with 1X PBS, and fixed for 20 min using 4% paraformaldehyde. The fixative was removed, cells were washed twice, and subsequently permeabilized for 5 min using 0.1% Triton-X in 1X PBS. Cells were then blocked with 1% bovine serum albumin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) in 1X PBS for 20 min. After washing, cells were stained for 30 min with Alexa Fluor™488 Phalloidin (Thermo Fisher Scientific, Inc.), by adding 100 µl of the working stain solution (0.165 µM) to each well in the dark. The cells were washed twice, and counterstained with Hoechst 33342 for 15 min by adding 100 µl of the working stain solution (1 µg/ml) to each well in the dark. Stained cells were mounted in 1X PBS and sealed with a cover slip. Slides were observed under a fluorescence microscope (Olympus FSX100™; Olympus Corporation, Tokyo, Japan) at 400× magnification, using the green fluorescent filter (λex/λem: 490/525 nm) to visualize stained filamentous actin structures, and the blue fluorescent filter (λex/λem: 355/465 nm) to visualize the nuclei.

Cells were seeded and transfected with a pTargeT™ KRAS construct (wild-type or mutant) in 12-well plates as previously described. Upon reaching full confluence, the cell monolayer was scratched with a sterile white pipette tip, washed with 1X PBS, and fed with serum-depleted media (2.5% BCS). Bright field and fluorescence images of the same gap area were captured in 4-h intervals starting immediately after the scratch was made. The rate of wound closure was quantified over a 16-h interval, at which point the gaps were still defined by drawing parallel lines along the cell migration front and measuring the difference in gap distance using imaging software (Olympus DP2-BSW; Olympus Soft Imaging Solutions GmbH, Münster, Germany). Additional scratch wound assay experiments were performed to visually track migrating cells. In these parallel experiments, cells were cotransfected with each pTargeT™ construct and pmR-ZsGreen1 in a 1:7 vector ratio (pmiR-ZsGreen1: pTargeT) as previously described and wound gaps were observed over a 40-h interval, to track the expression of the fluorescent reporter.

CellTiter 96^® AQueous One Solution Cell Proliferation Assay (Promega Corporation) was used to measure the rate of cell proliferation. Transfected cells in 12-well plates were trypsinized at 37°C 24 h post-transfection. For each transfection reaction, the detached cell suspension was split into two aliquots, and cells were collected via centrifugation at 400 × g at room temperature for 2 min. One half of the cells was resuspended in complete, serum-rich media (10% BCS), while the other half was resuspended in serum-depleted media (2.5% BCS). The cells in both suspensions were stained at room temperature with trypan blue for 5 min and subsequently quantified using a hemocytometer. The suspensions were diluted to a final concentration of 2,500 cells/100 µl. An equal number of cells (i.e., 2,500) were seeded in triplicate in two 96-well plates, corresponding to two time points at which the number of viable cells was measured (i.e., 48 and 72 h post-transfection). The plates were incubated in a humidified atmosphere containing 5% CO₂ at 37°C and processed 48 and 72 h post-transfection. To process a plate for spectrophotometric analysis, 10 µl of CellTiter 96^® AQueous One Solution was added to each well followed by a 2 h incubation to facilitate color development. Simultaneously, wells with predetermined cell counts were also prepared to serve as standards. Absorbance value of each well was measured at 490 nm by a colorimetric plate reader (FLUOstar Omega Microplate Reader, BMG LABTECH, Cary, NC, USA). A standard curve showing the linear relationship between absorbance value and cell count was generated and used to quantify the number of viable cells in each well. The cell counts of all transfectants were compared at both time points and statistically analyzed.

The 293 cells with an ELK-TAD luciferase reporter assay system (Signosis Inc., Silicon Valley, San Francisco, USA; cat. no. SL-0040-FP) was used to measure the ability of the KRAS mutants to activate the mitogen-activated protein kinase (MAPK) signaling pathway. The cell line is stably integrated with a fusion protein of the ELK-transactivation domain and Gal4. Activation of ELK-TAD through the MAPK pathway drives the expression of firefly luciferase, which is regulated by Gal4-UAS. Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin/streptomycin, then incubated in a humidified atmosphere containing 5% CO₂ at 37°C. For the luciferase assay, 10,000 cells were seeded into each well of a 96-well plate. Cells were then transfected with 200 ng of the pTargeT-KRAS constructs per well using Lipofectamine™ 2000. Twenty-four hours post-transfection, the media was changed to DMEM supplemented with 4% FBS to serum deprive the cells, which were then allowed to grow a further 24 h prior to the assay. Cells were lysed by adding 20 µl of Passive Lysis Buffer (cat. no. E1941; Promega Corporation) into each well, followed by a 20-min incubation at room temperature. The cell lysates were transferred into an opaque 96-well white plate, and 100 µl of the Luciferase Assay Reagent (Promega Corporation; cat. no. E1483) was added into each well. The plate was read using a luminometric plate reader (FLUOstar Omega Microplate Reader, BMG LABTECH) under the pre-set Firefly luciferase settings. Readings were normalized against the relative cell count measured through fluorescent staining of the cells' DNA using the CyQUANT NF Cell Proliferation Assay kit (Thermo Fisher Scientific Inc.; cat. no. C35007), according to the manufacturer's protocols, on transfected cells in parallel wells. Cells in these wells had their media removed, and 100 µl of the CyQuant NF reagent was added per well. The plate was then incubated at 37°C for 1 h. Fluorescence measurements were performed using a plate reader (FLUOstar Omega Microplate Reader, BMG LABTECH) with an excitation wavelength of 485 nm, and emission detection at 530 nm.

The functional impact of KRAS E31D and E63K mutations was assessed using three sequence-based prediction platforms: Polymorphism Phenotyping (POLYPHEN-2; version 2) (22), Sorting Intolerant From Tolerant (SIFT; version 5.2.2) (23) and Mutation Assessor (release 2) (24).

The impact of the amino acid changes on KRAS protein structure was evaluated by building homology models of the mutants based on the solved 3D structure of human KRAS (PDB: 3GFT). As 3GFT harbors the Q61H mutation, the wild-type structure was initially prepared by reverting this activating mutation in silico. The mutants were built in Accelrys Discovery Studio Client 2.5 (Dassault Systèmes BIOVIA, San Diego, CA, USA) using the MODELER protocol, which scores and optimizes the conformation of a mutated residue and its neighbors within a defined structure (15). The global main chain root-mean-square distance (RMSD) of each mutant model was then computed based on sequence alignment with the wild-type.

The putative effect of the mutants on GTP binding was assessed by simulating ligand-receptor interactions. First, the GTP ligand was prepared by generating multiple docking poses based on optimum conformations, tautomers, and isomers at the physiological pH. Similarly, the mutated KRAS structures were prepared using a general protocol that cleans the protein structure, removes water molecules, and optimizes the side-chain conformation for residues within the binding site (25). A minimization step was also performed to the cleaned protein models in order to minimize the energy of the structure, relax the protein conformation, and remove steric overlaps that may produce inaccurate interactions. Using the binding site coordinates defined by the reference solved crystal structure, the generated ligand poses were docked within the binding sphere of each KRAS protein variant. The CDOCKER algorithm was used to generate the docked conformations of the ligand (26). The calculated docking scores were compared among the different forms of KRAS.

All quantitative data were presented as mean ± standard error. One-way analysis of variance with post hoc Tukey's Honest Significant Differences was performed to compare and evaluate the quantitative results of the cellular assays. A P-value of 0.05 was used for all assays.

The flattened phenotype of normal non-transformed NIH3T3 fibroblasts was predominant in cells transfected with the empty expression vector. Non-transformed cells are reasoned to be flat and well-spread because of the appropriate and well established adhesion of cells onto the culture substrate (27). On the other hand, transformed NIH3T3 cells are characteristically smaller, rounder, and highly refractile compared with their non-transformed counterparts (28,29). Transformed cells also possess pronounced pseudopods and cellular protrusions (8). These characteristics likely reflect cytoskeletal reorganization resulting in poor surface adhesion and promotion of cellular motility.

Compared with the vector control, no significant morphological changes were seen in cells overexpressing the wild-type protein (Fig. 1). This observation is corroborated by previous reports that amplified expression of normal RAS is usually not sufficient for cellular transformation and therefore produces no discernible morphological changes in NIH3T3 cells (28,29).

As expected, a significant fraction of cells transfected with constitutively active forms of KRAS, including KRAS G12D and KRAS G13D, showed morphological features that mirror those of transformed fibroblasts, as the cells became smaller, rounder, and more refringent (Fig. 1). Cytoplasmic shrinkage was also apparent in the transfected fibroblasts. A significant percentage (P<0.05) of cells transfected with either the KRAS E31D (33%) or KRAS E63K (38%) mutant also share the morphology typical of transformed cells, hinting at the transformation potential of the rare mutations. While equal cell densities among the treated cells could not be guaranteed at the observation time-point, considering the combined cytotoxic and proliferative effects of transfection and KRAS overexpression, respectively, the trend of increased morphological aberration in KRAS-mutant overexpressing cells was highly reproducible. In all our experiments it was also ensured that morphology assessment was performed before cells reached full confluence and that any perceived differences in cell densities can be attributed to the aforementioned morphological changes.

Activating RAS mutations are known to affect actin organization, consequently facilitating the onset of cellular transformation (30). To determine if the rare KRAS mutations under study have the same deleterious impact on cytoskeletal dynamics similar to canonical mutants, filamentous actin of transfected cells was visualized via fluorescence staining. Transfected cells cultured in 8-well chamber slides were washed, fixed and permeabilized prior to staining. High-affinity binding of phalloidin to actin was used to visualize the actin cytoskeleton. Hoechst was used to counter-stain the nuclei.

Whereas the vector control- and wild-type-expressing cells exhibited prominent and well-oriented stress fibers, all canonical- and rare mutant-expressing cells developed poorly defined and thin stress fibers (Fig. 2). In KRAS E31D- and KRAS E63K-transfected cells, as well as in the positive controls, cell depolarization was apparent with extensive membrane ruffling and lamellipodia formation around the cell periphery. Formation of filopodia and pseudopodia were also increased. Altogether, these cytoskeletal features are typical of contractile and motile cells with highly dynamic actin networks, suggesting the effect of the rare KRAS mutants on cellular migration.

The proliferation rates of cells transfected with the KRAS E31D and KRAS E63K mutants were assessed and compared with the vector, wild-type, and canonical mutant controls (Fig. 3). This was done by seeding an equal number of cells that have been transfected for 24 h onto 96-well plates in triplicates and quantifying the number of viable cells via a colorimetric reagent 48 and 72 h post-transfection. At high serum concentration (10%), all transfectants showed comparable number of viable cells at the observed time points (Fig. 3A). In contrast, in serum-depleted (2.5%) conditions, cells expressing KRAS G12D, KRAS G13D, KRAS E31D, and KRAS E63K all showed a significant increase in cell count 72 h post-transfection (Fig. 3B). The assays also indicated that the absolute number of viable cells was, as expected, dependent on serum concentration.

Given the impact of KRAS E31D and KRAS E63K overexpression on cellular morphology and cytoskeletal actin, scratch wound assays were performed to investigate cell motility and its association with the expression of the rare mutants. The transfected cell monolayers were grown to full confluence, upon which a scratch was introduced using a sterile pipette tip. The cultures were then shifted to serum-depleted media (2.5%) and the wound fields were observed in a time-course manner. In some trials, pmR-ZsGreen1 was co-transfected with the expression vectors to ascertain, through expression of the fluorescent protein, whether migrating cells were positively transfected or otherwise.

Wound gaps were routinely observed at 4-h intervals until the confluent monolayer for each transfected culture was restored. As it became difficult to delineate the opposing migrating fronts beyond a certain time point, as cells started to extensively populate the gap wound from either side, the rate of wound closure was calculated 16 h post-scratch (Fig. 4A). The gap closure rates in cells expressing KRAS E31D and KRAS E63K mutants were significantly higher (P<0.05) compared with the vector and wild-type controls, and comparable with cells expressing the constitutively active forms of KRAS (Fig. 4B). Further, in co-transfected setups, fluorescent cells were particularly prominent midway the closing gap for cultures transfected with either KRAS E31D or KRAS E63K (Fig. 4C). The same was observed for cultures transfected with either canonical mutant. Although non-fluorescent cells were also present in the gap it is highly likely that these cells harbor the KRAS construct regardless, since cells were transfected with a 1:7 vector ratio (pmiR-ZsGreen1: pTargeT). Altogether, these results imply that positively transfected cells were more likely to migrate into the gap, suggesting the functional consequence of the mutations on cell motility.

In contrast, at 40 h following wounding, even fewer fluorescent cells were spotted halfway into the scratch wound of cells transfected with either the empty vector or wild-type KRAS, and a conspicuous gap could still be seen under the green fluorescent filter. Because transfection efficiency was consistent among treatments based on fluorescent quantification using fluorescence microscopy (data not shown), this underscores the comparable tendency for migration of empty vector- and KRAS-WT-transfected cells, adding evidence to the limited transforming effect of wild-type KRAS overexpression. For the empty vector and wild-type KRAS-transfected cultures, non-fluorescent cells were able to migrate into the gaps, due to the relatively long observation period. These cells most likely reached their terminal positions at reduced velocities, as indicated by the data on wound closure rates.

To determine whether KRAS E31D and KRAS E63K have an effect on downstream targets, an ELK-TAD luciferase reporter assay was employed. ELK-1 is an established nuclear target and one of the best characterized substrates of ERK, a downstream effector of KRAS (31,32). The different KRAS constructs were transfected into a 293 cell line harboring a stably integrated ELK/luc reporter to monitor their effects on ELK-1 transactivation. As shown in Fig. 5, the canonical mutants KRAS G12D and KRAS G13D, as well as the novel mutant KRAS E63K, consistently stimulated ELK-1-mediated transcriptional response. KRAS E31D, on the other hand, only showed stimulation of ELK-1 in two out of three trials and only achieved significance in one trial (P<0.05). As discussed below, in silico analyses suggested that the effects of this mutation may be benign. However, given the consistent and comparably aggressive phenotypic readout of this mutant compared with KRAS G12D and KRAS G13D in the different cancer hallmark assays, this may mean that KRAS E31D mediates its effects not through ELK-1, but via another downstream target.

The effect of E31D and E63K mutations on KRAS GTPase function was predicted using three bioinformatics platforms: PolyPhen-2 (22), which utilizes a physical and comparative approach in relating structure to function; SIFT (23), which yields predictions based on sequence homology and physical properties of pertinent amino acids; and Mutation Assessor (24), which relies on the evolutionary conservation of the mutated amino acid in protein homologs. In all platforms, E31D was predicted to have null to minimal effect on protein function, whereas E63K scored high ratings of potential functional impact in PolyPhen-2 and SIFT (Table I). However, these predictions only analyze the protein in isolation, precluding the possible effects of a mutation on the binding of regulators, including adaptors, scaffolds, and other proteins in a signalosome, in addition to effectors.

Similar to the canonical mutants KRAS G12D and KRAS G13D, both KRAS E31D and KRAS E63K have minimal effect on the overall structure of KRAS, based on the calculated RMSD values (Fig. 6). However, all mutants resulted in apparent conformational changes in a region critical to the GTPase activity of the protein, the mobile loop switch I, whose relative orientation dictates the activity status of KRAS. In both KRAS E31D and KRAS E63K, noticeable repositioning of the switch I loop was observed. The canonical mutants KRAS G12D and KRAS G13D resulted in a reorientation of the same loop. Perturbations caused by the canonical mutants are corroborated by crystal structures solved previously (33).

Docking simulations using CDOCKER were performed to determine the effect of mutations on ligand binding. CDOCKER functions on an algorithm wherein the receptor is held rigid while the ligand is allowed to flex during pose refinement. The homology mutant models of KRAS E31D, E63K, G12D, and G13D were prepared and minimized prior to docking. A total of 64 poses of the pH-optimized GTP ligand were generated for the simulations, with considerations to possible conformations, tautomers, and isomers. For each variant of KRAS, 192 GTP-receptor complex poses were scored. As shown by the minimum docking scores, KRAS G13D had the most favorable interaction with GTP, followed by the wild-type, E31D, E63K, and finally, the G12D mutant (Fig. 7). The exergonic CDOCKER energy values for all KRAS variants predicted unimpeded and highly favorable ligand binding. In all cases, the highly negative triphosphate moiety of GTP was correctly oriented toward the positively charged metal cofactor within the binding pocket.